a participatory method for designing sustainable health it

A comperhensive method for the selection of sustainable materials for buiding contruction

A comperhensive method for the selection of sustainable materials for buiding contruction

... 1993, it devoted itself to creating a practice of sustainable forestry Trang 19worldwide Forest Management Standards and the required management plan from every landowner make forests sustainable ... (Barbara Lippiatt, Anne Lanfield Greig and Priya Lavappa, 2011) 2.3.2.3 U.S Life-Cycle Inventory (LCI) Database This database is created by National Renewable Energy Laboratory (NREL) and its ... its partners This publicly available database allows users to review objectively and compare analysis results that are based on similar data collection and analysis methods It covers 19 categories

Ngày tải lên: 01/06/2018, 14:49

215 140 0
A health map for urban planners Towards a conceptual model for healthy, sustainable settlements

A health map for urban planners Towards a conceptual model for healthy, sustainable settlements

... Trang 1A health map for urban plannersTowards a conceptual model for healthy, sustainable relationship between people and their environment with a public health approach which identifies ... At the same Local Agenda 21, and now, in the UK, community strategies and ‘spatial plans’, are putting municipalities under an obligation to build bridges across the organizational chasms that ... is a move to integrate health impact assessment with environmental and social impact assessment, thus creating an integrated regimefor project appraisal All these changes are so profound as to

Ngày tải lên: 19/10/2022, 03:51

24 5 0
báo cáo hóa học:" A promising method for identifying cross-cultural differences in patient perspective: the use of Internet-based focus groups for content validation of new Patient Reported Outcome assessments" potx

báo cáo hóa học:" A promising method for identifying cross-cultural differences in patient perspective: the use of Internet-based focus groups for content validation of new Patient Reported Outcome assessments" potx

... either a quali-tative tradition, based on an inductive and phenomeno-logical approach; or a quantitative tradition, based on a deductive and positivistic approach [53,54] By nature, qualitative focus ... devel-opment based on geographically and culturally limited sampling A major advantage of IFGs over traditional face-to-face focus groups is they extend the researcher's ability to span geographical barriers ... or moderate acne • Seen a dermatologist in the past 2 years for their acne • An oily scalp and were also balding (males only) • Represented Asian, Black, Latino/Hispanic, White/ Caucasian peoples

Ngày tải lên: 20/06/2014, 15:20

14 442 0
Báo cáo toán học: " A novel method for crystalline silicon solar cells with low contact resistance and antireflection coating by an oxidized Mg layer" ppt

Báo cáo toán học: " A novel method for crystalline silicon solar cells with low contact resistance and antireflection coating by an oxidized Mg layer" ppt

... Provisional PDF corresponds to the article as it appeared upon acceptance. Fully formatted PDF and full text (HTML) versions will be made available soon. A novel method for crystalline silicon solar ... printed Ag metal paste forms too high potential barrier to form an ohmic contact with an n+ region, a new material can be inserted between Ag and Si to form low barrier height (Φ B ) and thus ... complicated, making it difficult for mass production [9]. To have similar effects without using the selective emitter method, a barrier material can be introduced between the Ag and Si since it

Ngày tải lên: 20/06/2014, 21:20

14 649 0
Báo cáo hóa học: " Research Article A New Method for Least-Squares and Minimax Group-Delay Error Design of Allpass Variable Fractional-Delay Digital Filters" pdf

Báo cáo hóa học: " Research Article A New Method for Least-Squares and Minimax Group-Delay Error Design of Allpass Variable Fractional-Delay Digital Filters" pdf

... that the performance in group delay and phase for the proposed systems can be improved drastically by appropriately specifying the range of fractional delay For the computational complexity, although ... International Symposium on Circuits and Systems, pp 2641–2645, May 1998. [7] T I Laakso, V V¨alim¨aki, M Karjalainen, and U K Laine, “Splitting the unit: delay tools for fractional delay filter ... Trang 1Volume 2010, Article ID 976913, 10 pagesdoi:10.1155/2010/976913 Research Article A New Method for Least-Squares and Minimax Group-Delay Error Design of Allpass Variable Fractional-Delay

Ngày tải lên: 21/06/2014, 07:20

10 492 0
Báo cáo hóa học: " Research Article A New Method for Solving Monotone Generalized Variational Inequalities" ppt

Báo cáo hóa học: " Research Article A New Method for Solving Monotone Generalized Variational Inequalities" ppt

... convergent algorithms for monotone and generalized variational inequality problems with Lipschitzian condition and without Lipschitzian condition.Section 3deals with some preliminary results ... 23 introduced a dual extrapolation method for solving variational inequalities Instead of working on the primal space, this method performs a dual step on the dual space In this paper we extend ... monotone generalized variational inequalities Instead of working on the primal space, this method performs a dual step on the dual space by using the dual gap function Under the suitable conditions,

Ngày tải lên: 21/06/2014, 07:20

20 414 0
Báo cáo hóa học: " Research Article A Novel Method for Improving Fairness over Multiaccess Channels" pdf

Báo cáo hóa học: " Research Article A Novel Method for Improving Fairness over Multiaccess Channels" pdf

... show the Average AME for the six methods which are compared As it was already pointed out previously, OMA achieves always the maximum possible AME We can notice fromFigure 2(b)that SIC and TS yield ... models In all cases, the new strategy provides the best tradeoff between fairness and AME 2 Fairness 2.1 Formulas for OMA and SIC It is well known for OMA method that the degree of fairness among ... with what we have in the corner points of the sum-capacity facet, we assume that all cancellations are perfect, and what is forwarded to the next decoder Trang 5OMA TS BORG∗2 SIC2−1 R1 R2  (a)

Ngày tải lên: 21/06/2014, 11:20

10 386 0
Báo cáo hóa học: "Research Article Evaluation of a Validation Method for MR Imaging-Based Motion Tracking Using Image Simulation" ppt

Báo cáo hóa học: "Research Article Evaluation of a Validation Method for MR Imaging-Based Motion Tracking Using Image Simulation" ppt

... reference data and the validation method may lack an appropriate reference This paper evaluates a validation method using simulated MR image data This provided an appropriate reference and allowed ... using a marker tracking algorithm which itself is validated against simulated MR image data Simulated data was generated for the noise-free case as well Trang 9SNR 0.01 0.015 0.02 Max Mean Min (a) ... that whenz ais larger than T the weight w a =0 2.4 Evaluation of Marker Tracking Method Using Simulated Magnitude MR Image Data The marker tracking method was evaluated using simulated magnitude

Ngày tải lên: 21/06/2014, 19:20

11 344 0
Báo cáo hóa học: " A New Method for Estimating the Number of Harmonic Components in Noise with Application in High Resolution Radar" pdf

Báo cáo hóa học: " A New Method for Estimating the Number of Harmonic Components in Noise with Application in High Resolution Radar" pdf

... subspace approach to multiple emitter location and spectral estimation, Ph.D thesis, Stanford University, Stanford, Calif, USA, 1981 [3] A Paulraj, R Roy, and T Kailath, “A subspace rotation approach ... reformulating the estimation problem as a classification problem with two classes An analytical demonstration is provided for a special case of a piecewise linear variation of the autocorrelation matrix ... subspace dimension Thus, it performs better than AIC and MDL methods, in white and especially colored noise, and it has a better behavior than the GDE criterion against white noise and with respect

Ngày tải lên: 23/06/2014, 01:20

12 409 0
Everyone Is a Customer - A Proven Method for Measuring the Value of Every Relationship in the Era of Collaborative Business pot

Everyone Is a Customer - A Proven Method for Measuring the Value of Every Relationship in the Era of Collaborative Business pot

... interaction at a time In iterative relationships... see a clear value proposition, just as each customer sees a clear value proposition in a traditional customer business relationship ... each customer on an increasingly personalized basis Thus it requires the entity that builds the. .. relationships (and all relationships are iterative), each relationship starts with an ... What we hadn’t appreciated is that in addition to requiring a lot of hard work, successful col- Introduction xxiii laborative relationships require an analytical and disciplined approach

Ngày tải lên: 28/06/2014, 08:20

236 508 0
Everyone Is a Customer - A Proven Method for Measuring the Value of Every Relationship in the Era of Collaborative Business pdf

Everyone Is a Customer - A Proven Method for Measuring the Value of Every Relationship in the Era of Collaborative Business pdf

... interaction at a time In iterative relationships... see a clear value proposition, just as each customer sees a clear value proposition in a traditional customer business relationship ... each customer on an increasingly personalized basis Thus it requires the entity that builds the. .. relationships (and all relationships are iterative), each relationship starts with an ... What we hadn’t appreciated is that in addition to requiring a lot of hard work, successful col- Introduction xxiii laborative relationships require an analytical and disciplined approach

Ngày tải lên: 28/06/2014, 22:20

236 618 0
Báo cáo khoa hoc:" A rapid method for computing the inverse of the gametic covariance matrix between relatives for a marked " pdf

Báo cáo khoa hoc:" A rapid method for computing the inverse of the gametic covariance matrix between relatives for a marked " pdf

... Trang 1© INRA, EDP Sciences, 2001Original article A rapid method for computing the inverse of the gametic covariance matrix between relatives for a marked Quantitative Trait Locus Gamal ABDEL-AZIM∗, ... be assigned to the unknown parentsand the problem becomes a pedigree with incomplete marker data For incom-plete marker data, alternative exact and approximate approaches are available Trang ... individuals i and j by R(i, j) Now given that 5 and 6 Trang 6158 G Abdel-Azim, A.E Freeman · The variance and covariance of Mendelian sampling for an individual with twoalleles at the marked QTL for

Ngày tải lên: 09/08/2014, 18:21

21 305 0
Báo cáo khoa hoc:" A sampling method for estimating the accuracy of predicted breeding values in genetic evaluation" potx

Báo cáo khoa hoc:" A sampling method for estimating the accuracy of predicted breeding values in genetic evaluation" potx

... EBV accuracy estimated by a sampling method 475 and 2 y ∼ N Xb, ZAZ σa + Iσe (3) 2 where A is the numerator relationship matrix, and the scalars σa and σe are the additive and residual variance ... time for very large data files Two advantages of the method are that a) it is applicable to any model (animal, sire, multivariate, maternal effects ) and b) it supplies off-diagonal coefficients ... This method was validated using an animal model with a sub-sample of data recorded on the French Parthenaise breed It was then applied to all the Salers breed animals involved in the French on-farm

Ngày tải lên: 09/08/2014, 18:21

14 296 0
Báo cáo y học: "miRTRAP, a computational method for the systematic identification of miRNAs from high throughput sequencing data" pptx

Báo cáo y học: "miRTRAP, a computational method for the systematic identification of miRNAs from high throughput sequencing data" pptx

... endogenous human Argonautes and their miRNA partners in RNA silencing Proc Natl Acad Sci USA 2008, 105:7964-7969 33 Katayama S, Tomaru Y, Kasukawa T, Waki K, Nakanishi M, Nakamura M, Nishida H, Yap CC, ... resources are available on our website [49] Additional material Additional file Supplemental methods, Supplemental Figures to and Supplemental Tables to Additional file Supplemental Table List of all ... miRs Abbreviations AAPD: average antisense product displacement; miRNA/miR: microRNA; miRTRAP: miRNA Tests for Read Analysis and Prediction; moR: microRNA-offsetRNA; piRNA: Piwi-interacting RNA;

Ngày tải lên: 09/08/2014, 20:21

12 557 0
everyone is a customer a proven method for measuring the value of every relationship in the era of collaborati phần 2 ppsx

everyone is a customer a proven method for measuring the value of every relationship in the era of collaborati phần 2 ppsx

... mantra—collaborate, collaborate, orate But what is collaboration and why is everyone talking collab-about it? Collaboration has many meanings, depending with whomyou speak Some call collaboration the ability ... nations are fluidand have always iterated as each nation learns more about howthe other can help it achieve its goals In essence, what this Col-laborative Community of nations is doing is trading cash ... interaction at a time In iterative relationships (and all relationships are iterative),each relationship starts with an assumption about the needs andwants the relationship is trying to satisfy and how

Ngày tải lên: 10/08/2014, 11:20

24 325 0
everyone is a customer a proven method for measuring the value of every relationship in the era of collaborati phần 3 docx

everyone is a customer a proven method for measuring the value of every relationship in the era of collaborati phần 3 docx

... Lexington, Massachusetts. If you are a customer selling a home, traditionally you deal with a real estate company briefly. It finds you a buyer, and you pay it a commission but never see it again. But ... transparent access to the specific infor- mation each requires. In addition, this multiple community participation provides its participants the opportunity to share information across the various ... that busi- nesses participate in a community only if they see clear and prof- itable value propositions. In essence, the Collaborative Community affords each busi- ness member transparent access

Ngày tải lên: 10/08/2014, 11:20

24 365 0
everyone is a customer a proven method for measuring the value of every relationship in the era of collaborati phần 4 ppt

everyone is a customer a proven method for measuring the value of every relationship in the era of collaborati phần 4 ppt

... real incentive for forming a collaborative relationship is a value proposition that brings creased strategic value to each party And strategic value is created in-whenever an exchange helps each ... problems, a way of think-ing that doesn’t come naturally to people trained and motivated compa-to act aucompa-tonomously OBSTACLES TO EFFECTIVE COLLABORATION Just as the majority of alliances and partnerships ... collaborative relationships requiresnew skills and new measurement tools so they can be managedfor both risk and advantage Trang 3of company structure, it was inevitable, actually even desirable,to

Ngày tải lên: 10/08/2014, 11:20

24 302 0
USAID Supported a Wide Range of Child and Maternal Health Activities, but Lacked Detailed Spending Data and a Proven Method for Sharing Best Practices pptx

USAID Supported a Wide Range of Child and Maternal Health Activities, but Lacked Detailed Spending Data and a Proven Method for Sharing Best Practices pptx

... Global Health repair in West Africa and making newborn health a priority in Latin America and the Caribbean Finally, the Bureau for Global Health gave technical assistance and administered a grants ... Survival and Maternal Health account in fiscal years 2004 and 2005 helped fund wide-ranging efforts to lower maternal and child mortality in Africa, Asia and the Near East, and Latin America and ... countries in Africa, Asia and the Near East, and Latin America and the Caribbean and to the Bureau for Global Health In allocating the funds, the agency considered various factors in its annual budgeting...

Ngày tải lên: 28/03/2014, 09:20

64 383 0
báo cáo khoa học: "The behaviour change wheel: A new method for characterising and designing behaviour change interventions" pps

báo cáo khoa học: "The behaviour change wheel: A new method for characterising and designing behaviour change interventions" pps

... system For example, opportunity can influence motivation as can capability; enacting a behaviour can alter capability, motivation, and opportunity Page of 11 Figure The COM-B system - a framework for ... place for a specified behavioural target to be achieved?’ The ‘intervention mapping’ approach is based on an epidemiological analysis of co-variation within the behavioural domain and starts with ... educational materials) and organisational interventions (local consensus processes); ‘financial’ includes individual and organisational incentives and environmental restructuring (changing the available...

Ngày tải lên: 10/08/2014, 10:23

12 330 0
Tài liệu Báo cáo khoa học: A facile method for expression and purification of the Alzheimer’s disease-associated amyloid b-peptide pdf

Tài liệu Báo cáo khoa học: A facile method for expression and purification of the Alzheimer’s disease-associated amyloid b-peptide pdf

... 5¢-GTTCACCACCAGAAGCT GGTGTTCTTCGCTGAAGACGTGGGTTCTAACAAG GGTGCT-3¢; Abc, 5¢-CACAACGCCACCAACCATCAGA CCGATGATAGCACCCTTGTTAGAACCCAC-3¢; Abstart, 5¢-GCGTAGGGTCGACATATGGACGCTGAATT CCGTCACG-3¢; Abstop, ... 5¢-CCTGCCGAGCTCCTATTA CACAACGCCACCAACCATCAG-3¢ The PCR solution was prepared in the buffer supplied with the enzyme, and contained Aba, Abb and Abc at 40 nm each, and the start and stop primers Abstart ... Chemicals, Toyko, Japan) using a Varian Pro Star 410 autosampler (Varian Inc., Palo Alto, CA, USA), and eluted at 1.5 mLÆmin)1 with a 14–49% acetonitrile gradient using a Varian Pro Star HPLC...

Ngày tải lên: 18/02/2014, 13:20

16 691 0
w