... for Laboratory Animal Research (Guide for the Care and Use of Laboratory Animals) in accordance with the ARVO Statement for the “Use of Animals in Ophthalmic and Vision Research” and were approved ... red) are located at the border of the vascularized and the avascular central zone in the superficial layer (s) Microglial cells (GFP, green) near vascular tufts are not activated as they are ramified ... microglial cells Page of from the three fields of each counting position (central or peripheral zone, and layer) was calculated Then, the mean and standard error of these means from at least retinas...
Ngày tải lên: 19/06/2014, 22:20
... M, Hagiwara S, Aiba M, Kubo O: Spontaneous regression of primary intracranial germinoma A case report Cancer 1997, 79:558-563 Murai Y, Kobayashi S, Mizunari T, Ohaki Y, Adachi K, Teramoto A: Spontaneous ... Spontaneous regression of a germinoma in the pineal body after placement of a ventriculoperitoneal shunt J Neurosurg 2000, 93:884-886 Sato A, Sakurada K, Kuge A, Ito M, Akasaka M, Kayama T: Spontaneous ... (CT) scan and a single cranial digital subtraction angiography (DSA) Fourteen days after the first MRI 12 and eight days after the CT scan and DSA, respectively - a pre-operative MRI was taken,...
Ngày tải lên: 11/08/2014, 00:22
Báo cáo y học: " Anti-Fas mAb-induced apoptosis and cytolysis of airway tissue eosinophils aggravates rather than resolves established inflammation" docx
... lavage (BAL) and dissection of the lungs and tracheobronchial airways Bronchoalveolar lavage (BAL) and quantification of luminal cells BAL was performed via a ligated tracheal cannula One ml of ... 44 Ohta K, Yamashita N, Tajima M, Miyasaka T, Kawashima R, Nakano J, Arioka H, Ishii A, Horiuchi T, Miyamoto T: In vivo effects of apoptosis in asthma examined by a murine model Int Arch Allergy ... h after each treatment (OVA/OVA+ IgG and OVA/OVA + anti-Fas mAb) (Figure 1) One group of animals with established eosinophilia treated with anti-Fas mAb was followed for 72 h after intra-nasal...
Ngày tải lên: 12/08/2014, 18:22
Tài liệu Báo cáo khoa học: "Using Smaller Constituents Rather Than Sentences in Active Learning for Japanese Dependency Parsing" docx
... languages and other parsing algorithms First we take languages similar to Japanese in terms of syntax, i.e., Korean and Mongolian These two languages are basically headfinal languages and have similar ... Proc of COLT ’92, pages 287–294 Masakazu Iwatate, Masayuki Asahara, and Yuji Matsumoto 2008 Japanese dependency parsing using a tournament model In Proc of COLING 2008, pages 361–368 Min Tang, Xaoqiang ... informative for the classifier (c) Have annotators label the m examples (d) Train a new classifier on all labeled examples Japanese is a head final language and in written Japanese we usually hypothesize...
Ngày tải lên: 20/02/2014, 04:20
Tài liệu David prefers to live in the country rather than live in the city doc
... rather than” dùng cấu trúc “ prefer to something rather than (do) something else” với ngh a “ là” "Prefer … rather than"- cách dùng “verb phrase” nhằm nhấn mạnh "thích làm kia" => Dịch câu: David ... đến Ta có cụm từ: “in the country”- miền quê “in the city”- thành thị -“rather than”- là: Trong “ rather” trạng từ (abverb) có ngh a là, thích …hơn “than” liên từ ( conjunction) có ngh a hơn(để ... *David prefers to live in the country rather than live in the city Hình thức ngữ pháp : Cấu trúc “ prefer to something rather than (do) something else” – ( thích làm việc việc kia) Chúng ta quan...
Ngày tải lên: 26/02/2014, 00:20
17% of cell phone owners do most of their online browsing on their phone, rather than a computer or other device pdf
... sample frames and the relative sizes of each frame and each sample The second stage of weighting balances sample demographics to population parameters The sample is balanced to match national ... interviewers asked to speak with the youngest adult male or female currently at home based on a random rotation If no male/female was available, interviewers asked to speak with the youngest adult of the ... born and non-U.S born The White, non-Hispanic subgroup is also balanced on age, education and region The basic weighting parameters came from a special analysis of the Census Bureau’s 2011 Annual...
Ngày tải lên: 29/03/2014, 20:20
ESPON 2013 DATABASE QUALITY RATHER THAN QUANTITY… potx
... defined as Methods, Application, Data and Metadata Data and metadata The amount of data present in the ESPON database is the most obvious output of a project called “Database” It is also the easiest ... management and the maintenance of both data and metadata in the ESPON Database Flexible database schemas have been designed and built for handling long term storage of statistical and spatial data, ... data and metadata formats so that they can be uploaded on the ESPON DB Application server The ESPON DB metadata profile has been created because an indepth analysis of the state of the art has...
Ngày tải lên: 30/03/2014, 22:20
a universe from nothing why there is something rather than nothing
... galaxy had always been carried away with that velocity, we can work backward and figure out how long ago it would have been at the same position as our galaxy Since galaxies twice as far away ... faster velocities! When first presented with this remarkable fact-that almost all galaxies are moving away from us, and those that are twice as far away are moving twice as fast, those that are ... propose a Big Bang was a Belgian priest and physicist named Georges Lemaitre Lemaitre was a remarkable combination of proficiencies He started his studies as an engineer, was a decorated artilleryman...
Ngày tải lên: 05/06/2014, 11:24
Báo cáo hóa học: " Impairment of the CD8+ T cell response in lungs following infection with human respiratory syncytial virus is specific to the anatomical site rather than the virus, antigen, or route of infection" pdf
... spleens primary data of flow cytometry analysis of tetramer/pentamer+CD8+ and IFNγ+CD8+ cells from the lungs and Examples of primary data of flow cytometry analysis of tetramer/pentamer+CD8+ and IFNγ+CD8+ ... Eur J Immunol 2006, 36:1434-1442 Claassen EA, Kant PA van der, Rychnavska ZS, van Bleek GM, Easton AJ, Most RG van der: Activation and inactivation of antiviral CD8 T cell responses during murine ... two animals euthanized on each day: day 2, 2.9 and
Ngày tải lên: 20/06/2014, 01:20
phân vân cách dùng rather than
... before "rather than" With practice and deeper understanding of the verb structures, you will soon learn how to apply the correct form In the meanwhile, try to remember as many as possible the examples ... rather than relating to people in the real work The verb structure is "to spend (time) doing something" To know when to use an infinitive, a noun, a noun phrase, or a V-ing after "rather than", ... risk of social isiolation ,a problem occasionally seen in people who spend too much time at their computer rather than relating to to people in the real world, People who spend too much time at...
Ngày tải lên: 13/07/2014, 13:10
Báo cáo sinh học: "Process rather than pattern: finding pine needles in the coevolutionary haystack" doc
... Translating the outcomes of experimental studies such as that of Piculell et al [9] into real-world coevolutionary mosaics at the appropriate geographic scale remains a distant goal In the meantime, ... interspecific interactions [25]; that in some areas, traits will be mismatched (local maladaptation) [26]; and finally that there will be few species-level traits that have become fixed as a result of coevolution ... between populations to enable genes that are favorable to track the conditions in which they are favorable, and to allow the maintenance of genetic variation that would otherwise disappear [11,22]...
Ngày tải lên: 06/08/2014, 18:21
Báo cáo y học: "In adult onset myositis, the presence of interstitial lung disease and myositis specific/associated antibodies are governed by HLA class II haplotype, rather than by myositis subtype" pdf
... especially in patients possessing anti-aminoacyl transfer RNA (tRNA) synthetase antibodies and/or ILD [4-6] These alleles form part of a conserved, ancestral Caucasian haplotype containing A1 -B8Cw7-DRB1*0301-DQA1*0501 ... determination of MSAs/MAAs Anti-PM-Scl, anti-Mi-2, anti-Ku, anti-U3RNP, anti-U1RNP, anti-SRP, and the anti-tRNA synthetases (anti-Jo-1, anti-PL-7, anti-PL-12, anti-EJ, anti-OJ, and anti-KS) were all ... myositis-specific/myositisassociated antibody (MSA/MAA) profiles [4] Most patients possessing anti-signal recognition particle antibody (SRP) have PM, whereas an antibody against part of the nucleosome remodelling and...
Ngày tải lên: 09/08/2014, 07:20
Báo cáo y học: "Anti-inflammatory effect of antidiabetic thiazolidinediones prevents bone resorption rather than cartilage changes in experimental polyarthritis" pps
... 5'-AAGATGGGTCACCAGCAGCTCTACTG-3' 67 59 Aggrecan Sense: 5'-ACACCCCTACCCTTGCTTCT-3' 124 58 59 56 92 56 433 58 362 57 Antisense: 5'-AGACGCGGCAAGAGCGAGAA-3' Antisense: 5'-AAAGTGTCCAAGGCATCCAC-3' PPAR-α ... 16 Tanaka T, Yamamoto J, Iwasaki S, Asaba H, Hamura H, Ikeda Y, Watanabe M, Magoori K, Ioka RX, Tachibana K, Watanabe Y, Uchiyama Y, Sumi K, Iguchi H, Ito S, Doi T, Hamakubo T, Naito M, Auwerx ... 5'-GATGACCTGGAAAGTCCCTT-3' Antisense: 5'-CTTGAATGTTTCCCATCTCTT-3' PPAR-γ Sense: 5'-ATGGGTGAAACTCTGGGAGAT-3' Antisense: 5'-GGTAATTTCTTGTGAAGTGCT-3' Adiponectin Sense: 5'-AATCCTGCCCAGTCATGAAG-3' Antisense:...
Ngày tải lên: 09/08/2014, 10:22
Báo cáo y học: "Excessive substance use in bipolar disorder is associated with impaired functioning rather than clinical characteristics, a descriptive study" pdf
... statistical analyses and wrote the first draft of the paper and coordinated the writing process OAA, KS and IM participated in planning of the study, supervised the data collection and statistical analyses ... pathophysiological influence of substances across different age periods Predominantly daily use of alcohol and predominantly weekly use of a non-alcoholic substance throughout an age interval across a minimum ... additional value, in that we demonstrate that SUD criteria are not necessarily the appropriate cut-off when addressing and assessing harmful substance use in BD Our findings may also have important...
Ngày tải lên: 11/08/2014, 16:22
báo cáo khoa học: " The Washington Needle Depot: fitting healthcare to injection drug users rather than injection drug users to healthcare: moving from a syringe exchange to syringe distribution model" pps
... the amount of needles that a person can obtain within a given period and, as a result, significantly reduce the impact of NEPs [13] Various rationales are at the base of exchange approaches to ... Reduction: Come as you are Addictive Behaviors 1996, 21:779-788 Tang SY, Browne AJ: 'Race' matters: racialization and egalitarian discourses involving aboriginal people in the Canadian health care context ... that has to be tied to needle exchange This process was taking place at many levels The City of Vancouver, for example, installed a needle receptacle, in the artful shape of a daisy, in a park...
Ngày tải lên: 11/08/2014, 18:21
Báo cáo y học: "The International Sepsis Forum’s controversies in sepsis: my initial vasopressor agent in septic shock is norepinephrine rather than dopamine" pot
... and the autoregulation of cerebral blood flow impaired In this situation it is possible that the cerebral vascular response to catecholamines may be altered The cerebral effects of dopamine and ... Levy B, Bollaert PE, Charpentier C, Nace L, Audibert G, Bauer P, Nabet P, Larcan A: Comparison of norepinephrine and dobutamine to epinephrine for hemodynamics, lactate metabolism, and gastric tonometric ... dose of norepinephrine was titrated up in stages to achieve a mean arterial pressure (MAP) of 65 mmHg, 75 mmHg, and finally 85 mmHg The mean doses of norepinephrine required to maintain these MAPs...
Ngày tải lên: 12/08/2014, 19:21
Báo cáo y học: "The International Sepsis Forum’s controversies in sepsis: my initial vasopressor agent in septic shock is dopamine rather than norepinephrine" pptx
... Available online http://ccforum.com/content/7/1/6 Norepinephrine increases cardiac index This is an advantage of dopamine and actually a major advantage Although some studies have demonstrated ... increases portal lactate levels in sheep Additional points A number of additional points are worthy of mention First, dopamine has been shown in rats to increase the clearance of pulmonary oedema ... the patient usually has no neurological sequelae Norepinephrine has no effect on the hypothalamic–pituitary axis This is indeed true, because dopamine administration can reduce the release of a...
Ngày tải lên: 12/08/2014, 19:21
Báo cáo y học: "Analysis of XMRV integration sites from human prostate cancer tissues suggests PCR contamination rather than genuine human infection" ppt
... tgagccagatcatgcctctgcactccagcctgggcaacagagcaagactc ************************************************** EU981808 GU816103 catctcaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa catctcaaaaaaaaaaaaaaaaaaaaaaaaaa -******************************** ... ATTGACTACCCAGCTCGGGGGTCTTTCAaaagcacaca ************************************** EU981808 GU816103 gatataagtgctgtcatatagtaaatgcctaaataaaagtgttttgtgta gatataagtgctgtcatatagtaaatacctaaataaaagtgttttgtgta ... gatataagtgctgtcatatagtaaatacctaaataaaagtgttttgtgta ************************** *********************** EU981808 GU816103 gttttaatttatattctatttttcagaaacacaactaccatataaactga gttttaatttatattctatttttcagaaacacaactaccatataaactga **************************************************...
Ngày tải lên: 13/08/2014, 01:20