a novel drug target for hdl and atherosclerosis

Heat shock protein 70–2 (HSP70-2) is a novel therapeutic target for colorectal cancer and is associated with tumor growth

Heat shock protein 70–2 (HSP70-2) is a novel therapeutic target for colorectal cancer and is associated with tumor growth

... is associated with tumor growth Nirmala Jagadish1, Deepak Parashar1, Namita Gupta1, Sumit Agarwal1, Vaishali Suri2, Rajive Kumar3, Vitusha Suri4, Trilok Chand Sadasukhi4, Anju Gupta5, Abdul S Ansari6, ... shRNA3, CGG CGA CAA ATC AGA GAA TGT; shRNA4, TTC GAC GCC AAG AGG CTG CTG ATT) and Control shRNA (NC shRNA, 5’-ATCTCGCTTGGGCGAGAGTAAG-3’) were obtained from Super Array (Sure Silencing shRNA Plasmid, ... et al Cancer testis antigens: A new paradigm for cancer therapy OncoImmunology 2012;1:1194–6 10 Agarwal A, Parashar D, Gupta N, Jagadish N, Thakar A, Suri V, et al Sperm associated antigen (SPAG9)

Ngày tải lên: 20/09/2020, 15:06

13 11 0
a dual specificity kinase dyrk1a as a potential therapeutic target for head and neck squamous cell carcinoma

a dual specificity kinase dyrk1a as a potential therapeutic target for head and neck squamous cell carcinoma

... squamous cell carcinoma Aneesha Radhakrishnan1,2, Vishalakshi Nanjappa1,3, Remya Raja1, Gajanan Sathe1,4, Vinuth N. Puttamallesh1,3, Ankit P. Jain1,5, Sneha M. Pinto1, Sai? ?A.  Balaji6, Sandip Chavan1,4, ... Sandip Chavan1,4, Nandini? ?A.  Sahasrabuddhe1, Premendu P. Mathur2,5, Mahesh M. Kumar7, T. S. Keshava Prasad1,3,8, Vani Santosh9, Geethanjali Sukumar1, Joseph? ?A.  Califano10,11, Annapoorni Rangarajan6, David Sidransky11, ... David Sidransky11, Akhilesh Pandey12,13,14,15, Harsha Gowda1,8 & Aditi Chatterjee1,8 Despite advances in clinical management, 5-year survival rate in patients with late-stage head and neck squamous

Ngày tải lên: 08/11/2022, 14:58

13 10 0
A novel sequential algorithm for clutter and direct signal cancellation in passive bistatic radars

A novel sequential algorithm for clutter and direct signal cancellation in passive bistatic radars

... sequential algorithm for clutter and direct signal cancellation in passive bistatic radars Farzad Ansari1 , Mohammad Reza Taban2* and Saeed Gazor3 Abstract Cancellation of clutter and multipath is an ... observed Ansari et al EURASIP Journal on Advances in Signal Processing (2016) 2016:134 a Page of 11 Table Clutter and target parameters in scenario #2 for calculation of CA and TA in SCB, ECA and SCA ... clutter /target before and after the clutter and direct signal cancellation, respectively For evaluating the SCB algorithm in comparison with the ECA, SCA and ECA-B algorithms using the CA and Table

Ngày tải lên: 19/11/2022, 11:44

11 2 0
mir 139 5p as a novel serum biomarker for recurrence and metastasis in colorectal cancer

mir 139 5p as a novel serum biomarker for recurrence and metastasis in colorectal cancer

... Candidate miRNAs were then tested in two independent cohorts of 111 stage II/III and 139 stage I-III CRC patients, as well as serum samples and matched primary and metastatic liver tissues An ... Translational Genomics and Oncology, Baylor Scott & White Research Institute and Sammons Cancer Center, Baylor University Medical Center, Dallas, Texas, USA 2Department of Gastroenterology and ... recurrence and metastasis in CRC Colorectal cancer (CRC) is one of the most common malignancies worldwide, as well as a major cause of cancer-related deaths1–3 Approximately 60% of CRC patients have

Ngày tải lên: 04/12/2022, 15:34

13 0 0
Evaluation of MiR-1908-3p as a novel serum biomarker for breast cancer and analysis its oncogenic function and target genes

Evaluation of MiR-1908-3p as a novel serum biomarker for breast cancer and analysis its oncogenic function and target genes

... University: reagents purchasing Availability of data and materials The datasets used and/ or analyzed during the current study are available from the corresponding author on reasonable request Ethics approval ... rapamycin) signaling pathway, FoxO (forkhead box O) signaling pathway and ErbB signaling pathway Due to the complex interactions between miRNAs and their target mRNAs in vivo, one miRNA may target multiple ... RGMA, EFCAB1, ALX4, OSR1 and PPARA) and the serum level of miR-1908-3p could be used as a diagnostic and predictive biomarker for breast cancer Author details Department of Thyroid and Breast

Ngày tải lên: 06/08/2020, 05:32

12 9 0
The breakfast club for 40 somethings a novel approach to unlearning money and reinventing your life

The breakfast club for 40 somethings a novel approach to unlearning money and reinventing your life

... job and holiday to holiday, looking for happiness and finding nothing more than moments Unlearning vague wants and unarticulated desires and getting clarity are critical to achieving your financial ... always as they seem, and Karen and Russ face challenges that are familiar to so many of us — juggling parenting, ageing parents, money pressures and work hassles Here are their vital stats: married ... relax in a way she had not for a long time, as the steam dampened her hair and Brad’s arms encircled her She had enjoyed their nights together more than she cared to admit, and had fallen back

Ngày tải lên: 03/01/2020, 10:40

117 77 0
RGS6 as a novel therapeutic target in CNS diseases and cancer

RGS6 as a novel therapeutic target in CNS diseases and cancer

... JR, Berman DM, Gilman AG, Kozasa T RGS4 and GAIP are GTPase-activating proteins for Gq alpha and block activation of phospholipase C beta by gamma-thio-GTP-Gq alpha Proc Natl Acad Sci U S A 1997;94(2):428–32 ... by a grant from the National Cancer Institute, CA161882, and by a grant from the American Heart Association, 14GRNT20460208 We thank our collaborators as well as current and past Fisher laboratory ... cravings and withdrawal symptoms and there are no drugs that have been approved to prevent/treat alcohol-related organ damage Part of the problem is that alcohol does not have a specific molecular target

Ngày tải lên: 11/05/2020, 11:48

13 22 0
Reverse pharmacophore mapping and molecular docking studies for discovery of GTPase HRas as promising drug target for bis-pyrimidine derivatives

Reverse pharmacophore mapping and molecular docking studies for discovery of GTPase HRas as promising drug target for bis-pyrimidine derivatives

... docking studies for? ?discovery of GTPase HRas as promising drug target for? ?bis‑pyrimidine derivatives Sanjiv Kumar1, Jagbir Singh1, Balasubramanian Narasimhan1*  , Syed Adnan Ali Shah2,3, Siong Meng Lim2,4, ... Siong Meng Lim2,4, Kalavathy Ramasamy2,4 and? ?Vasudevan Mani5 Abstract  Background:  Pyrimidine is an important pharmacophore in the field of medicinal chemistry and exhibit a broad spectrum of biological potentials ... several decades As such, the *Correspondence: naru2000us@yahoo.com Faculty of Pharmaceutical Sciences, Maharshi Dayanand University, Rohtak 124001, India Full list of author information is available

Ngày tải lên: 29/05/2020, 13:21

11 45 0
Chk1 Inhibition as a novel therapeutic strategy for treating triple-negative breast and ovarian cancers

Chk1 Inhibition as a novel therapeutic strategy for treating triple-negative breast and ovarian cancers

... Fanconi anaemia and BRCA proteins Nat Rev Genet 2007, 8:735–748 29 Chen CC, Kennedy RD, Sidi S, Look AT, D’Andrea A: CHK1 inhibition as a strategy for targeting Fanconi Anemia (FA) DNA repair pathway ... [26] and AZD7762 [27] in combination with a range of standard of care chemotherapy drugs It has also been postulated that DNA damage response checkpoints and especially Chk1 kinase activity may ... Results Pharmacological abrogation of Chk1 activity inhibits cell proliferation and induces caspase activation in human triple-negative breast and ovarian cancer cell lines Sporadic basal-like

Ngày tải lên: 14/10/2020, 13:47

14 14 0
A novel hysteretic model for magnetorheological fluid dampers and parameter identification using particle swarm optimization

A novel hysteretic model for magnetorheological fluid dampers and parameter identification using particle swarm optimization

... conventional viscous damping and spring stiffness This approach, as an attractive feature, maintains a relationship between the damper parameters and physical force-velocity hysteretic phenomena and ... search, optimization and machine learning,” Addison-Wesley, Reading, MA, 1989 [15] M Iwasaki, M Miwa and N Matsui, ”GA-based evolutionary identification algorithm for unknown structured mechatronic ... also features a fail-safe mode, acting as a conventional damper, and in case of hazardous situations as encountered in earthquakes where power supply may be interrupted Although the MR damper

Ngày tải lên: 19/10/2022, 09:32

24 5 0
A novel hysteretic model for magnetorheological fluid dampers and parameter identification using particle swarm optimization

A novel hysteretic model for magnetorheological fluid dampers and parameter identification using particle swarm optimization

... conventional viscous damping and spring stiffness This approach, as an attractive feature, maintains a relationship between the damper parameters and physical force-velocity hysteretic phenomena and ... search, optimization and machine learning,” Addison-Wesley, Reading, MA, 1989 [15] M Iwasaki, M Miwa and N Matsui, ”GA-based evolutionary identification algorithm for unknown structured mechatronic ... also features a fail-safe mode, acting as a conventional damper, and in case of hazardous situations as encountered in earthquakes where power supply may be interrupted Although the MR damper

Ngày tải lên: 19/10/2022, 11:14

24 8 0
a novel iminosugar uv 12 with activity against the diverse viruses influenza and dengue novel iminosugar antiviral for influenza and dengue

a novel iminosugar uv 12 with activity against the diverse viruses influenza and dengue novel iminosugar antiviral for influenza and dengue

... 23-plex Assay) All samples were analyzed as recommended by the manufacturer (Bio-Rad, Hercules, CA, USA) 2.4.5 Statistical Analysis Survival data was analyzed in GraphPad Prism using log-rank analysis ... Roche/Hitachi 902 Analyzer (Hitachi High-Technologies Corporation, Tokyo, Japan) for the following parameters: Alanine Aminotransferase, Albumin, Alkaline phosphatase, Aspartate Aminotransferase, ... 0.09 NA b Tmax reported as median (min-max); AUCinf and nominal doses were used for absolute bioavailability (F) calculation; c back extrapolated concentration at time zero; NA: Not applicable for

Ngày tải lên: 02/11/2022, 08:47

25 2 0
a novel scheduling framework for qos aware ofdma resource allocation in a network with small relay cells and macro users

a novel scheduling framework for qos aware ofdma resource allocation in a network with small relay cells and macro users

... framework for QoS-aware OFDMA resource allocation in a network with small relay cells and macro users Venkatkumar Venkatasubramanian* and Thomas Haustein Abstract Relaying is a convenient way ... Trondheim, Norway, 3–4 June 2008, Paper ID W08114 A Saleh, S Redana, B Raaf, T Riihonen, J Hamalainen, R Wichman, Performance of amplify -and- forward and decode -and- forward in LTE-advanced in Proceddings ... relays, indoor relay measurements were conducted at an indoor cell 485 m away from a serving base station A detailed Venkatasubramanian and Haustein EURASIP Journal on Wireless Communications and

Ngày tải lên: 02/11/2022, 08:49

18 6 0
global proteome and phospho proteome analysis of merlin deficient meningioma and schwannoma identifies pdlim2 as a novel therapeutic target

global proteome and phospho proteome analysis of merlin deficient meningioma and schwannoma identifies pdlim2 as a novel therapeutic target

... CCGGCTCGGAAGTCTTCAAGATGCTCTCGAGAGCATCTTGAAGACTTCCGAGTTTTTTG; sequence clone 2: CCGGGCTCTTACATGAGCTAAGTTTC TCGAGAAACTTAGCTCATGTAAGAGCTTTTTTG; sequence clone 3: CCGGGAGGACATACACTGAGAGTCACTCGAGTGACTCTCAGTGTATGTCCTCTTTTTTG; ... Meningioma and Schwannoma Identifies PDLIM2 as a Novel Therapeutic Target Kayleigh Bassiri a, 1, Sara Ferluga a, 1, Vikram Sharma b, Nelofer Syed c, Claire L Adams a, Edwin Lasonder b, C Olivier Hahnemann ... the database for annotation, visualization and integrated discovery (DAVID) software (Huang da et al., 2009) for Gene Ontology (GO) annotations and for KEGG pathways annotations Functional enrichment

Ngày tải lên: 04/12/2022, 10:35

11 4 0
integrative analysis of copy number and transcriptional expression profiles in esophageal cancer to identify a novel driver gene for therapy

integrative analysis of copy number and transcriptional expression profiles in esophageal cancer to identify a novel driver gene for therapy

... Esophageal cancer, classified as esophageal squamous cell carcinoma (ESCC) and esophageal adenocarcinoma (EAC), is the sixth leading cause of cancer death worldwide1,2 Currently, the standard therapy ... prognosis and was correlated with a malignant phenotype, which makes it a novel biomarker and a potential therapeutic drug target in the field of esophageal carcinoma Results Comprehensive analysis ... expression of FAM6 0A and clinical data were also explored Additionally, the function of FAM6 0A was validated in two esophageal cancer cell line, Eca-109 and TE-13 Finally, the potential mechanism by

Ngày tải lên: 04/12/2022, 15:00

12 9 0
HEALTH PROJECT MANAGEMENT A MANUAL OF PROCEDURES FOR FORMULATING AND IMPLEMENTING HEALTH PROJECTS potx

HEALTH PROJECT MANAGEMENT A MANUAL OF PROCEDURES FOR FORMULATING AND IMPLEMENTING HEALTH PROJECTS potx

... the organizational and managerial approaches available for implementation; these range from having the activities undertaken by an existing organization to creating a special project organization ... (Chapters 2, 3, and 4) requires the collection and analysis of a great deal of information In general, the team should concentrate on collecting data for specific uses; random and arbitrary information ... or looping back: that is, some steps are done initially and are redone later on when more inforn- ation becomes availablẹ Strategies and targets, for example, are first set and may later be revised

Ngày tải lên: 07/03/2014, 02:20

143 524 0
Báo cáo hóa học: " A novel cloning strategy for isolating, genotyping and phenotyping genetic variants of geminiviruses" pdf

Báo cáo hóa học: " A novel cloning strategy for isolating, genotyping and phenotyping genetic variants of geminiviruses" pdf

... http://www.virologyj.com/content/5/1/135 (A) A T A A T T T A A T C (B) G C C G G/GATCCAAGCGGTCATCCGTATAATATTACCGGATGGCCGC/GGCCGCAAAAGAGCT/C C G BamHI NotI SacI T A A T C G T G G C G C C G AAG CGCCTTTTCCT original viral sequence ... CATGATCAACTGCTCTGATTAC GGGCTTCCCGTACTTTGTG TGGATTTAGCTCCCTGAATG TYLCV primers for Q-PCR (176 bp amplicon) Ty 2164+ Ty 2339- CTAAGAGCCTCTGACTTACTGC AACATTCAGGGAGCTAAATCCAG 200 nM 200 nM Actin2 ... GGTCGCTTCGACATARTCACG 200 nM 200 nM Sequencing of TYLCV cloned sequences pGreen1589 (+) pG1825(-) 579 (+) 1141 (+) 1741(+) 2321(+) CACGACGTTGTAAAACGACG CACAGGAAACAGCTATGACC GATGTTACTCGTGGATCTGG CATGATCAACTGCTCTGATTAC...

Ngày tải lên: 20/06/2014, 01:20

10 398 0
Báo cáo hóa học: " A novel simultaneous dynamic range compression and local contrast enhancement algorithm for digital video cameras" potx

Báo cáo hóa học: " A novel simultaneous dynamic range compression and local contrast enhancement algorithm for digital video cameras" potx

... images To achieve local contrast enhancement with reduced artifacts, Tao and Asari [12] proposed an AINDANE algorithm which is comprised of two separate processes, namely, adaptive luminance and ... approximately ranges from 40 to 80 for the mean of regional standard deviation and from 100 to 200 for the image mean the mean of standard deviation and the mean of image, respectively In [23], the authors ... that the visually optimized images converge to a range of approximately 40-80 for global mean of regional standard deviation and 100-200 for global mean of the image, and they termed this range...

Ngày tải lên: 20/06/2014, 22:20

19 353 0
báo cáo hóa học: " Syndecan-1 antigen, a promising new target for triple-negative breast cancer immuno-PET and " potx

báo cáo hóa học: " Syndecan-1 antigen, a promising new target for triple-negative breast cancer immuno-PET and " potx

... in several cancer types, including breast, colorectal, gastric, pancreatic, prostate, lung, endometrial, and ovarian cancers, as well as squamous cell carcinoma of the head and neck and multiple ... model [15] Several radioimmunotherapy clinical trials have been performed for breast cancer treatment targeting Tag 72, mucin, CEA, and an adenocarcinoma antigen recognized by the ChL6 antibody [16-19] ... for the animal facility, participated in in vivo assays and in the radiolabeling of mAb AF-C was responsible for high activity mAb radiolabeling JW produced the B-B4 antibody and critically revised...

Ngày tải lên: 21/06/2014, 01:20

11 329 0
w