a novel cross species clustering algorithm

Báo cáo y học: " Strand-specific RNA sequencing reveals extensive regulated long antisense transcripts that are conserved across yeast specie" ppt

Báo cáo y học: " Strand-specific RNA sequencing reveals extensive regulated long antisense transcripts that are conserved across yeast specie" ppt

... GTAAAAGTATTTGGCTTCATTAG TGTGTGAAAAATAAAGAAAATAGATACAATACTATCGACGGTCGACGGATCCCCGGGTT and AAGA AAGTATATAAAATCTCTCTATATTATACAGGCTACTTCTTTTAGGAAACGTCACATCGATGAATTCGAGCTCGTT [32] Correct integration ... cerevisiae BY4741 Same as above with rrp6Δ::KANMX6 ATCC Saccharomyces cerevisiae BY4741 Same as above with hda2Δ::URA3 Gift from Oliver Rando’s lab Saccharomyces cerevisiae BY4741 Same as above ... reverse transcriptase (Qiagen - Valencia, CA, USA) and 500 ng of total RNA Each reaction was carried out at 50°C for 20 minutes, and heat inactivated at 70°C for 15 minutes PCR was conducted as for...

Ngày tải lên: 09/08/2014, 20:22

14 339 0
báo cáo hóa học:" Nutrition and inflammation serum biomarkers are associated with 12-week mortality among malnourished adults initiating antiretroviral therapy in Zambia" potx

báo cáo hóa học:" Nutrition and inflammation serum biomarkers are associated with 12-week mortality among malnourished adults initiating antiretroviral therapy in Zambia" potx

... Committee (Lusaka, Zambia), and the Page of Institutional Review Boards at the University of Alabama at Birmingham (Birmingham, Alabama, USA) and Vanderbilt University (Nashville, Tennessee, USA) Results ... Mtonga V, Reid S, Cantrell RA, Bulterys M, Saag MS, Marlink RG, Mwinga A, Ellerbrock TV, Sinkala M: Rapid scale-up of antiretroviral therapy at primary care sites in Zambia: feasibility and early ... with and without ART) [16], but absolute albumin values are an uncertain indicator of nutritional status in the presence of chronic inflammation Albumin is a negative acutephase reactant, and albumin...

Ngày tải lên: 20/06/2014, 08:20

8 299 0
Báo cáo y học: "erum levels of soluble receptor for advanced glycation end products and of S100 proteins are associated with inflammatory, autoantibody, and classical risk markers of joint and vascular damage in rheumatoid arthritis" doc

Báo cáo y học: "erum levels of soluble receptor for advanced glycation end products and of S100 proteins are associated with inflammatory, autoantibody, and classical risk markers of joint and vascular damage in rheumatoid arthritis" doc

... Kosaki A, Hasegawa T, Kimura T, Iida K, Hitomi J, Matsubara H, Mori Y, Okigaki M, Toyoda N, Masaki H, Inoue-Shibata M, Nishikawa M, Iwasaka T: Increased plasma S10 0A1 2 (ENRAGE) levels in patients ... manuscript Acknowledgements Supported by grants from the PA Hospital Foundation, Australian Rotary Health Research Fund, the National Health and Medical Research Council of Australia, and an Australian ... syndromes Eur Heart J 2007, 28:941-948 Mori Y, Kosaki A, Kishimoto N, Kimura T, Iida K, Fukui M, Nakajima F, Nagahara M, Urakami M, Iwasaka T, Matsubara H: Increased plasma S10 0A1 2 (EN-RAGE) levels...

Ngày tải lên: 09/08/2014, 13:22

11 420 0
Báo cáo sinh học: "Changes in muscle cell cation regulation and meat quality traits are associated with genetic selection for high body weight and meat yield in broiler chickens" ppt

Báo cáo sinh học: "Changes in muscle cell cation regulation and meat quality traits are associated with genetic selection for high body weight and meat yield in broiler chickens" ppt

... 2.7.3.2) activity was determined using a commercially available kit (Alpha Laboratories) and total plasma Ca++ and Mg++ concentrations were measured using commercial diagnostic kits (Wako Chemicals ... variance component to its standard error evaluated against a t-distribution An approximate a priori average standard error of 0.1 was estimated from the formula for the variance of the intraclass ... duplicate and the mean of the two second readings for each sample was taken for analysis Statistical analysis The experiment was a randomised block design Residuals were evaluated for normality and...

Ngày tải lên: 14/08/2014, 13:21

8 307 0
SPECIAL REPORT: National Survey of Children’s Health Finds Intact Family and Religious Participation Are Associated with Fewer Developmental Problems in School-Age Children pdf

SPECIAL REPORT: National Survey of Children’s Health Finds Intact Family and Religious Participation Are Associated with Fewer Developmental Problems in School-Age Children pdf

... such as Mississippi, Arkansas, Alabama, and Louisiana, less than half of all children live with both parents (Nowadays, 70 percent of black children nationwide are born outside of marriage, as are ... observations of national probability samples of programs, families, and children Dr Zill has been a senior technical adviser and lead analyst for the National Head Start Impact Study, a random-assignment ... Technical Planning Group on School Readiness for the National Education Goals Panel, and developed a child health index that the Goals Panel reported annually for each state and the nation as a whole...

Ngày tải lên: 28/03/2014, 09:20

36 343 0
báo cáo hóa học: " Indoors illumination and seasonal changes in mood and behavior are associated with the health-related quality of life" pdf

báo cáo hóa học: " Indoors illumination and seasonal changes in mood and behavior are associated with the health-related quality of life" pdf

... physiological pathway from the habitat to the health status and HRQoL, barriers to the physical and social activities are likely to have an impact on an individual basis Strengths and limitations Our data ... Englund A, Haukka J, Partonen T, Reunanen A, Aromaa A, Lönnqvist J: Seasonal changes in mood and behavior are linked to metabolic syndrome PLoS ONE 2008, 3:e1482 Kasper S, Wehr TA, Bartko JJ, Gaist ... Characterizing a mammalian circannual pacemaker Science 2006, 314:1941-1944 Stoleru D, Nawathean P, de la Paz Fernández M, Menet JS, Ceriani MF, Rosbash M: The Drosophila circadian network is a seasonal timer...

Ngày tải lên: 18/06/2014, 19:20

8 473 0
báo cáo hóa học: " Distress and quality of life characteristics associated with seeking surgical treatment for stress urinary incontinence" pptx

báo cáo hóa học: " Distress and quality of life characteristics associated with seeking surgical treatment for stress urinary incontinence" pptx

... Patient satisfaction has been measured with a visual analog scale (VAS), and a Patient Satisfaction Questionnaire (PSQ) that has not been validated, but includes a question asking patients how satisfied ... but no post-treatment data or only change data (no absolute values) and 14 studies presented data before and after surgery Pre-operative Data Severity was assessed with a questionnaire in three ... Authors' contributions Two of the authors (KG and AS) made substantial contributions to the conception and design of the study, acquisition of data, data analysis and interpretation of data All...

Ngày tải lên: 18/06/2014, 19:20

8 453 0
Báo cáo sinh học: " Typing of human rotaviruses: Nucleotide mismatches between the VP7 gene and primer are associated with genotyping failure" pdf

Báo cáo sinh học: " Typing of human rotaviruses: Nucleotide mismatches between the VP7 gene and primer are associated with genotyping failure" pdf

... TCTTGTCAAAGCAAATAATA Das primer, 9T1-1 5’ CAAGTACTCAAATCAGTGATGG Target sequence 3’ CAAGTACTCAAATCAATGATGG Gouvea primer, aBT1 Figure Nucleotide mismatches in the primers Nucleotide mismatches ... Linhares AC, Lanata CF, Hausdorff WP, Gabbay WP, Black RE: Reappraisal of the Peruvian and Brazilian lower titer tetravalent rhesus-human reassortant rotavirus vaccine efficacy trials: analysis ... 199:233-237 Iturriza-Gomara M, Kang G, Mammen A, Jana AK, Abraham M, Desselberger U, Brown D, Gray J: Characterization of G10P[11] rotaviruses causing acute gastroenteritis in neonates and infants in Vellore,...

Ngày tải lên: 19/06/2014, 08:20

5 391 0
báo cáo hóa học: " Serum lipid profiles are associated with disability and MRI outcomes in multiple sclerosis" pptx

báo cáo hóa học: " Serum lipid profiles are associated with disability and MRI outcomes in multiple sclerosis" pptx

... continuous variables expressed as mean ± SD and categorical variables as frequency (%) * At baseline lipid profile assessment §Statin usage status unavailable for one patient MRI data were available ... MRI data acquisition NB contributed to MRI data acquisition MR contributed to study design, data analysis and interpretation and manuscript preparation Al authors read and approved the final manuscript ... hypercholesterolemia and paraoxonase-1, the anti-oxidant enzyme associated with HDL, was decreased during relapses [12] A retrospective analysis of a large dataset of 8,983 patients from the North American Research...

Ngày tải lên: 19/06/2014, 22:20

7 614 0
báo cáo hóa học: " Low ficolin-3 levels in early follow-up serum samples are associated with the severity and unfavorable outcome of acute ischemic stroke" pptx

báo cáo hóa học: " Low ficolin-3 levels in early follow-up serum samples are associated with the severity and unfavorable outcome of acute ischemic stroke" pptx

... particle-enhanced immunturbidimetric assay, using an automated laboratory analyzer (Roche Cobas Integra 400, Basel, Switzerland) Statistical evaluation of the results Statistical analysis was performed ... participated in the collection and analysis of clinical data; ZP participated at the design of the study and drafting the manuscript All authors read and approved the final manuscript Acknowledgement ... Andersens Foundation, Rigshospitalet and Research Foundation of the Capital Region of Denmark, as well as by grants from the Hungarian National Research Fund (OTKA 77892 to ZI), the Hungarian Ministry...

Ngày tải lên: 19/06/2014, 22:20

27 434 0
Báo cáo hóa học: " Nucleotide mismatches between the VP7 gene and the primer are associated with genotyping failure of a specific lineage from G1 rotavirus strains" potx

Báo cáo hóa học: " Nucleotide mismatches between the VP7 gene and the primer are associated with genotyping failure of a specific lineage from G1 rotavirus strains" potx

... Dutta P, Bhattacharya SK, Krishnan T, Kobayashi N, Naik TN: Genetic variability of human rotavirus strains isolated from Eastern and Northern India J Med Virol 2004, 72:156-161 Rahman M, Sultana ... site Arch Virol 1997, 142:1881-1887 Taniguchi K, Wakasugi F, Pongsuwanna Y, Urasawa T, Ukae S, Chiba S, Urasawa S: Identification of human and bovine rotavirus serotypes by polymerase chain reaction ... 2001:1747-1785 Martella V, Ciarlet M, Baselga R, Arista S, Elia G, Lorusso E, Banyai K, Terio V, Madio A, Ruggeri FM, Falcone E, Camero M, Decaro N, Buonavoglia C: Sequence analysis of the VP7 and VP4...

Ngày tải lên: 20/06/2014, 01:20

4 330 0
báo cáo hóa học:" Decreased levels of serum glutathione peroxidase 3 are associated with papillary serous ovarian cancer and disease progression" pot

báo cáo hóa học:" Decreased levels of serum glutathione peroxidase 3 are associated with papillary serous ovarian cancer and disease progression" pot

... Sreekanthreddy P, Srinivasan H, Kumar DM, Nijaguna MB, Sridevi S, Vrinda M, Arivazhagan A, Balasubramaniam A, Hegde AS, Chandramouli BA, Santosh V, Rao MR, Kondaiah P, Somasundaram K: Identification ... USA) to separate serum Samples were then stored at -130°C until ELISA assay was performed ELISA assay Commercially available ELISA kits for measuring concentrations of GPX3, manufactured by Adipogen™ ... examined GPX3 levels in a broad array of cancer (Table 4), these studies provide the first analysis of this candidate biomarker in epithelial ovarian cancer, specifically, Agnani et al Journal...

Ngày tải lên: 20/06/2014, 08:20

8 439 0
Báo cáo lâm nghiệp: " Crown architecture and leaf habit are associated with intrinsically different light-harvesting efficiencies in Quercus seedlings from contrasting environments" ppt

Báo cáo lâm nghiệp: " Crown architecture and leaf habit are associated with intrinsically different light-harvesting efficiencies in Quercus seedlings from contrasting environments" ppt

... irradiance data obtained, the solar constant value required by Y-plant was set at 1150 µmol m−2 s−1 and rendered accurate simulations of the mean light availability of the plants Since last leaf ... area ratio of the shoot (LARshoot , leaf area divided by the dry mass of stems + branches + petioles + leaves); (4) leaf area of individual leaves to calculate mean leaf area (MLA) Structural ... internode length; D/H, diameter/height ratio; LARshoot , leaf area ratio; number of leaves; Ea , light harvesting efficiency; MLA, mean leaf area; LMA, leaf mass per area) and the scores of the first...

Ngày tải lên: 07/08/2014, 16:20

8 436 0
Báo cáo y học: "Angiogenic and angiostatic factors in systemic sclerosis: increased levels of vascular endothelial growth factor are a feature of the earliest disease stages and are associated with the absence of fingertip ulcers" doc

Báo cáo y học: "Angiogenic and angiostatic factors in systemic sclerosis: increased levels of vascular endothelial growth factor are a feature of the earliest disease stages and are associated with the absence of fingertip ulcers" doc

... disorganization of the capillary architecture and absent or some ramified capillaries Finally, the late pattern criteria were irregular enlargement of capillaries, few or absent giant capillaries, ... distribution and no evident loss of capillaries The criteria for the active pattern were frequent capillary hemorrhages and giant capillaries, moderate loss of capillaries with some avascular areas, mild ... 23–69 years) All patients and controls were of Caucasian origin Clinical assessment An extensive clinical profile was established for each preSSc patient and each SSc patient Patients’ characteristics...

Ngày tải lên: 09/08/2014, 06:22

10 432 0
Báo cáo khoa học: "Phospho-ERK and AKT status, but not KRAS mutation status, are associated with outcomes in rectal cancer treated with chemoradiotherapy" ppt

Báo cáo khoa học: "Phospho-ERK and AKT status, but not KRAS mutation status, are associated with outcomes in rectal cancer treated with chemoradiotherapy" ppt

... Luna-Perez P, Segura J, Alvarado I, Labastida S, Santiago-Payan H, Quintero A: Specific c-K-ras gene mutations as a tumor-response marker in locally advanced rectal cancer treated with preoperative ... had stage IV disease at diagnosis for Page of Table Patient characteristics and clinical data Characteristics Age at diagnosis N = 70 Median 58 years Range 42 (60%) 28 (40%) White 52 (74%) Black ... TF participated in clinical data collection AMD performed the statistical analyses JMD participated in the data analyses, interpretation of results, and drafted the manuscript BFC participated...

Ngày tải lên: 09/08/2014, 09:21

9 259 0
Báo cáo y học: "Proton-pump inhibitors are associated with a reduced risk for bleeding and perforated gastroduodenal ulcers attributable to non-steroidal anti-inflammatory drugs: a nested case-control study" pptx

Báo cáo y học: "Proton-pump inhibitors are associated with a reduced risk for bleeding and perforated gastroduodenal ulcers attributable to non-steroidal anti-inflammatory drugs: a nested case-control study" pptx

... of the univariate or multivariate analyses Table Multivariate analysis of significant variables and other likely causational variables for serious NSAID ulcer complications Predictor Adjusted OR ... statistical analysis of the data All authors read and approved the final manuscript Acknowledgements The authors wish to thank all participating community-based pharmacies in Enschede The authors ... ulcer bleeding associated with nonsteroidal anti-inflammatory drugs, antiplatelet agents, and anticoagulants Am J Gastroenterol 2007, 102:507-515 Lanas A, Garcia-Rodriguez LA, Arroyo MT, Gomollon...

Ngày tải lên: 09/08/2014, 10:20

8 460 0
Báo cáo y học: "Reduced proportions of natural killer T cells are present in the relatives of lupus patients and are associated with autoimmunity" ppt

Báo cáo y học: "Reduced proportions of natural killer T cells are present in the relatives of lupus patients and are associated with autoimmunity" ppt

... clinical data and laboratory samples PRF participated in study design, and coordinated acquisition of clinical data and laboratory samples, as well as entry of clinical and laboratory variables ... double-negative regulatory natural killer T cells in autoimmune diseases Arthritis Rheum 2001, 44:1127-1138 25 Oishi Y, Sumida T, Sakamoto A, Kita Y, Kurasawa K, Nawata Y, Takabayashi K, Takahashi ... Anti-double-stranded DNA (dsDNA) antibody levels were determined by an in house ELISA, using calf thymus dsDNA as a substrate Statistical analysis All data were verified and double entered in an Access database...

Ngày tải lên: 09/08/2014, 13:21

13 455 0
báo cáo khoa học: " Polymorphisms in the SULF1 gene are associated with early age of onset and survival of ovarian cancer" ppsx

báo cáo khoa học: " Polymorphisms in the SULF1 gene are associated with early age of onset and survival of ovarian cancer" ppsx

... 5’-TGG CAA TTT TGC TCT TTT CC-3’ A> G RP 5’-TGA CAT AGA GTG CCC AGG TG-3 rs6990375 FP 5’-CCG CAG AAC ACC GAA GTA AT-3’ G >A RP 5’-CCA GGG TAG CTT GGA ATG TT-3 rs3802278 G >A FP RP 5’-CTG GAA ACC GAT ... 5’-AAGAGCTCTTGGGAATGCCTCATAGACAG-3’ (forward) and 5’-AAGCTAGCGGTCTGAGAACTCCCAGTCAA-3’ (reverse) SacI and NheI restriction enzymes (New England BioLabs, Beverly, MA) were used to cleave the amplicons, and ... 2007 and diagnosed with histopathologically confirmed primary epithelial ovarian cancer Patients had been treated with chemotherapy, a combination of platinum (carboplatin, cisplatin) and taxanes...

Ngày tải lên: 10/08/2014, 10:20

7 355 0
Báo cáo y học: " The anti-inflammatory effects of the tellurium redox modulating compound, AS101, are associated with regulation of NFB signaling pathway and nitric oxide induction in macrophages" doc

Báo cáo y học: " The anti-inflammatory effects of the tellurium redox modulating compound, AS101, are associated with regulation of NFB signaling pathway and nitric oxide induction in macrophages" doc

... down-regulation of IkappaB kinase and NFkappaB activation in macrophages Biochem Pharmacol 2000, 60:1665-76 Kabe Y, Ando K, Hirao S, Yoshida M, Handa H: Redox regulation of NFkappaB activation: ... site specific (forward:CAAGCCAGGGT ATGTGGTTT; reverse:GCAGCAGCCATCAGGTA TTT) and non-specific (forward: TTGGCACCATC TAACCTCAC, reverse:TGGTGTATCCTCATGCAA GG) primers (Hy-Labs, Israel) in iNOS promoter ... degradation and NFB nuclear translocation The NFB complex functions as a key factor in inflammation AS101 treatment inhibits NFB activities and thereby acts as an anti-inflammatory agent in...

Ngày tải lên: 11/08/2014, 08:22

8 585 0
w