a novel concept for langmuir and langmuir blodgett films research

Báo cáo hóa học: " TSaT-MUSIC: a novel algorithm for rapid and accurate ultrasonic 3D localization" pdf

Báo cáo hóa học: " TSaT-MUSIC: a novel algorithm for rapid and accurate ultrasonic 3D localization" pdf

... we can estimate DOAs and delays with only three MUSIC algorithm executions The original TSaT-MUSIC algorithm is for DOA-delay estimation in a 2D space and can easily be extended to a localization ... configuration of a sensor array We assume that the transmitted signal consists of multicarrier ultrasonic waves and that a linear sensor Page of array is used The numbers of sensors and frequencies are ... this article as: Mizutani et al.: TSaT-MUSIC: a novel algorithm for rapid and accurate ultrasonic 3D localization EURASIP Journal on Advances in Signal Processing 2011 2011:101 when a true point...

Ngày tải lên: 20/06/2014, 22:20

8 433 0
báo cáo khoa học: " A novel method for efficient and abundant production of Phytophthora brassicae zoospores on Brussels sprout leaf discs" pot

báo cáo khoa học: " A novel method for efficient and abundant production of Phytophthora brassicae zoospores on Brussels sprout leaf discs" pot

... oleracea var gemmifera) and rutabaga (swedes) (Brassica napus var napobrassica) [6,7] P brassicae is mostly associated with post-harvest damage that limits the marketability of cabbage heads and can ... oleracea var alba Brassica oleracea var.gemmifera Brassica rapa subsp.pekinensis Brassica oleracea var.gemmifera 2.9 0.1 4.9 0.4 5.9 0.4 3.5 0.2 6.0 0.2 a the average size in cm2 of at least ... Hyaloperonospora arabidopsidis, Albugo candida and two Phytophthora species, P cinnamoni and P brassicae [1,11-13] The best studied Phytophthora species, i.e P infestans and P sojae, are incapable...

Ngày tải lên: 12/08/2014, 03:21

7 341 0
In vitro and in vivo investigation of nanoparticles of a novel copolymer for substained and controlled delivery of docetaxel

In vitro and in vivo investigation of nanoparticles of a novel copolymer for substained and controlled delivery of docetaxel

... chemotherapy, radiation therapy, immunotherapy, monoclonal antibody therapy and gene therapy Each method has its advantages and disadvantages, and depends on the physiology of the individuals as an ... of a wide range of local or metastatic malignancies such as ovarian, breast, head and neck and non-small-cell lung cancers (NSCLC) (Eisenhauer and Vermorken, 1998) On the other hand, they are also ... chemotherapeutic agents because of effective single-agent activity such as high response and patient survival rates in a broad spectrum of advanced carcinoma (Bunn and Kelly, 1998) And taxanes are...

Ngày tải lên: 09/10/2015, 11:18

163 941 0
Báo cáo khoa học: A novel pathway for sequential transformation of 7-dehydrocholesterol and expression of the P450scc system in mammalian skin pptx

Báo cáo khoa học: A novel pathway for sequential transformation of 7-dehydrocholesterol and expression of the P450scc system in mammalian skin pptx

... Primer location Amplified band (bp) P553 P554 P557 P558 GTGATTCTCTGCTAGATGTTG GGCACTCGAACAGTCATATTG ATTAAGGAGCTTCGGGAGATG CTCTTATACCCAATGCTGCTG First pair GCCTTTGAGTCCATCACTAAC CCAGTGTCTTGGCAGGAATC ... Right: human SBCE2 (lane 1), WM35 (lane 2), hamster AbC-1 (lane 3) and mouse S-91 (lane 4) melanomas; placenta (lane 5) The amount of protein loaded on gels was and lg for placenta (lanes and 2, ... Bioinformatics (to A. S.), UTHSC, and NIH grants 1R01-AR047079-0 1A2 (to A. S.) and RR017854 We thank Professor Cedric Shackelton, Children’s Hospital Oakland Research Institute, Oakland, CA, USA for...

Ngày tải lên: 23/03/2014, 13:20

11 478 0
Báo cáo toán học: " A novel method for crystalline silicon solar cells with low contact resistance and antireflection coating by an oxidized Mg layer" ppt

Báo cáo toán học: " A novel method for crystalline silicon solar cells with low contact resistance and antireflection coating by an oxidized Mg layer" ppt

... resistance To calculate the contact resistance, Mg was evaporated on the n-Si wafer, and the Ag paste was printed on the Si wafer for reference The contact resistances of Mg/Si and Ag/Si were measured ... ohmic contact with an n+ region, a new material can be inserted between Ag and Si to form low barrier height (ΦB) and thus to reduce the contact resistance Among various materials, Mg metal is selected ... Mater Sol Cells 2002, 73:209-219 Hilali MM, Nakayashiki K, Khadilkar C, Reedy RC, Rohatgi A, Shaikh A, Kim S, Sridharan S: Effect of Ag particle size in thick-film Ag paste on the electrical and...

Ngày tải lên: 20/06/2014, 21:20

14 649 0
báo cáo khoa học: "Gene-expression and network-based analysis reveals a novel role for hsa-mir-9 and drug control over the p38 network in Glioblastoma Multiforme progression" ppsx

báo cáo khoa học: "Gene-expression and network-based analysis reveals a novel role for hsa-mir-9 and drug control over the p38 network in Glioblastoma Multiforme progression" ppsx

... Materials and methods Gene datasets TCGA Data were obtained from The Cancer Genome Atlas (TCGA) database This dataset comprises of molecular characterizations from 373 GBM patients For each patient, ... mediated by p38-gamma and p38-delta pathway Celebrex COX2 Signaling mediated by p38-alpha and p38-beta pathway Cis Retinoic Acid RARA Map kinase inactivation of smrt co-repressor Sorafenib RAF1 ... tumor and its matched normal sample across all patients Table 2: Glioblastoma drug targets Drug name Target Pathway Accutane RARA Map kinase inactivation of smrt co-repressor CCNU STMN4 Signaling...

Ngày tải lên: 11/08/2014, 12:21

26 278 0
a novel scheme for human-friendly and time-delays robust neuropredictive teleoperation

a novel scheme for human-friendly and time-delays robust neuropredictive teleoperation

... telemanipulators have already been employed in rehabilitation and secure a greater and sooner impact on the life of many impaired persons However, an important drawback for such applications lays in that, ... natural variations “Engineering” simplified models, for qualitative analysis, have also appeared [31] Although models of arm impedance, based on only the measured “macroscopic” variables (arm force ... local master variables This way the “feel” of teleoperation is natural and human-friendly, since the variables are simultaneous, and also not altered by the algorithm, as in existing approaches...

Ngày tải lên: 26/10/2014, 14:31

30 188 0
Tài liệu Báo cáo khoa học: A facile method for expression and purification of the Alzheimer’s disease-associated amyloid b-peptide pdf

Tài liệu Báo cáo khoa học: A facile method for expression and purification of the Alzheimer’s disease-associated amyloid b-peptide pdf

... 5¢-CACAACGCCACCAACCATCAGA CCGATGATAGCACCCTTGTTAGAACCCAC-3¢; Abstart, 5¢-GCGTAGGGTCGACATATGGACGCTGAATT CCGTCACG-3¢; Abstop, 5¢-CCTGCCGAGCTCCTATTA CACAACGCCACCAACCATCAG-3¢ The PCR solution was prepared ... guidelines and using the following primers: Aba, 5¢-ATGGACGCTGAAT TCCGTCACGACTCTGGTTACGAAGTTCACCACCAG AAGCTGGTG-3¢; Abb, 5¢-GTTCACCACCAGAAGCT GGTGTTCTTCGCTGAAGACGTGGGTTCTAACAAG GGTGCT-3¢; Abc, 5¢-CACAACGCCACCAACCATCAGA ... enzyme, and contained Aba, Abb and Abc at 40 nm each, and the start and stop primers Abstart and Abstop at 600 nm each, and 200 lm each of dATP, dCTP, dGTP and dTTP The product was separated from...

Ngày tải lên: 18/02/2014, 13:20

16 691 0
Tài liệu Báo cáo khoa học: Development of a new method for isolation and long-term culture of organ-specific blood vascular and lymphatic endothelial cells of the mouse pdf

Tài liệu Báo cáo khoa học: Development of a new method for isolation and long-term culture of organ-specific blood vascular and lymphatic endothelial cells of the mouse pdf

... SV40T Ag and the 3¢ portion of the tsA58T Ag cDNA carrying the A4 38V mutation were PCR-amplified from COS-7 cDNAs using the following primers: LTA-1F, 5¢-CTC GAGATGGATAAAGTTTTAAACAGAG-3¢ and LTA1R, ... GAGATGGATAAAGTTTTAAACAGAG-3¢ and LTA1R, 5¢-TGAAGGCAAATCTCTGGAC-3¢ for the former, and LTA–M2F, 5¢-CAGCTGTTTTGCTTGAATTATG-3¢ and LTA–2R, 5¢-GAATTCATTATGTTTCAGGTTCA GGGG-3¢ for the latter The PCR products were ... Dong QG, Bernasconi S, Lostaglio S, De Calmanovici RW, Martin-Padura I, Breviario F, Garlanda C, Ramponi S, Mantovani A & Vecchi A (1997) A general strategy for isolation of endothelial cells from...

Ngày tải lên: 18/02/2014, 17:20

11 875 0
Tài liệu A Marketing Guide for Small and Medium Sized Primary Forest Products Processors pdf

Tài liệu A Marketing Guide for Small and Medium Sized Primary Forest Products Processors pdf

... Graduate Research Assistant Department of Wood Science and Forest Products Virginia Polytechnic Institute and State University Blacksburg, VA Published by: Northeastern Area State and Private Forestry ... Specialty Product A B C D Mass Market Niche Market F Bibliography Essel, A E 1993 Niche marketing—An alternative for small and part-time farmers Farm Management Update Blacksburg, VA: Virginia Tech ... instead They were transformed into marketing managers, marketing engineers and marketing associates, and some even became marketing representatives.” —Lamont C Blake Marketing Consultant As can...

Ngày tải lên: 18/02/2014, 22:20

92 2,2K 0
Tài liệu Báo cáo khoa học: "A Statistical Model for Unsupervised and Semi-supervised Transliteration Mining" pptx

Tài liệu Báo cáo khoa học: "A Statistical Model for Unsupervised and Semi-supervised Transliteration Mining" pptx

... Markov Models (Nabende, 2010; Darwish, 2010; Jiampojamarn et al., 2010), Finite State Automata (Noeman and Madkour, 2010) and Bayesian learning (Kahki et al., 2011) to learn transliteration pairs ... algorithm to estimate the counts of multigrams The algorithm has a forward variable α and a backward variable β which are calculated in the standard way (Deligne and Bimbot, 1995) Consider a node r which ... and North American Association for Computational Linguistics Conference, Edmonton, Canada A Kumaran, Mitesh M Khapra, and Haizhou Li 201 0a Report of NEWS 2010 transliteration mining shared task...

Ngày tải lên: 19/02/2014, 19:20

9 522 0
Tài liệu Báo cáo khoa học: "A Writing Assistant for CAT and CALL" pdf

Tài liệu Báo cáo khoa học: "A Writing Assistant for CAT and CALL" pdf

... Proceedings of ACL Y Ma, N Stroppa, and A Way 2007 Bootstrapping word alignment via word packing In Proceedings of ACL L Nepveu, G Lapalme, P Langlais, and G Foster 2004 Adaptive language and translation ... train TransAhead, we used British National Corpus and Hong Kong Parallel Text and deployed GENIA tagger for POS analyses To evaluate TransAhead in CAT and CALL, we introduced it to a class of 34 ... interactivity made translation and language learning more fun and the participants found TransAhead very recommendable and would like to use the system again in future translation tasks Acknowledgement...

Ngày tải lên: 22/02/2014, 03:20

4 393 0
Tài liệu A Science Roadmap for Food and Agriculture pdf

Tài liệu A Science Roadmap for Food and Agriculture pdf

... interfaces between animal agriculture and landscapes (natural, managed, and urban) New initiatives to characterize the genetic architecture and resources of various agriculture animals and aquaculture ... more accurate estimates of climate change impacts, the potential costs and benefits of adaptation, and to validate and calibrate models • Quantify costs and benefits of adaptation at the farm ... challenges and take advantage of any opportunities associated with climate change Policymakers will have information to facilitate adaptation and also minimize inequities in impacts and costs of Grand...

Ngày tải lên: 22/02/2014, 05:20

104 416 0
Tài liệu Báo cáo khoa học: "A COMMON FRAMEWORK FOR ANALYSIS AND GENERATION" potx

Tài liệu Báo cáo khoa học: "A COMMON FRAMEWORK FOR ANALYSIS AND GENERATION" potx

... the translations we have allocated to the lexical items in our vocabulary will be generated Tibia is true of all NL s!/stems that translate from a natural language into some formal representation ... system are acceptable as they are proposed, is more flexible than any approach which depends on getting a reaiisable expression of the representation language from the application program and systematically ... approach to generating text from a given logical form is described The algorithm described by Shieber and his colleagues takes a realisable A- calculus expression and uses their syntactic/semantic...

Ngày tải lên: 22/02/2014, 10:20

4 505 0
Hepatitis and Liver Cancer: A National Strategy for Prevention and Control of Hepatitis B and C ppt

Hepatitis and Liver Cancer: A National Strategy for Prevention and Control of Hepatitis B and C ppt

... is variability in coverage among states Additionally, there are racial and ethnic disparities in childhood vaccination rates—Asian and Pacific Islander (API), Hispanic, and African American children ... John Ward, Dale Hu, Cindy Weinbaum, and David Bell, Centers for Disease Control and Prevention; Chris Taylor and Martha Saly, National Viral Hepatitis Roundtable; Lorren Sandt, Caring Ambassadors ... Agency for Healthcare Research and Quality Acquired immunodeficiency syndrome Alanine aminotransferase Hepatitis B core antibody Hepatitis B surface antibody Hepatitis C antibody Asian and Pacific...

Ngày tải lên: 06/03/2014, 01:20

191 458 0
Hepatitis and Liver Cancer: A National Strategy for Prevention and Control of Hepatitis B and C doc

Hepatitis and Liver Cancer: A National Strategy for Prevention and Control of Hepatitis B and C doc

... and C http://www.nap.edu/catalog/12793.html Acronyms and Abbreviations AASLD ACIP ACOG AHRQ AIDS ALT anti-HBc anti-HBs anti-HCV API AST AVHPC American Association for the Study of Liver Diseases ... childhood vaccination rates—Asian and Pacific Islander (API), Hispanic, and African American children have lower vaccination rates than non-Hispanic white children Regarding vaccination of children and ... state and local governments, professional organizations, health-care organizations, and educational institutions) to develop hepatitis B and hepatitis C educational programs for health-care and...

Ngày tải lên: 06/03/2014, 01:20

253 375 0
Hate on the Internet: A Response Guide for Educators and Families pptx

Hate on the Internet: A Response Guide for Educators and Families pptx

... Partners Against Hate Hate on the Internet: A Response Guide for Educators and Families represents a collaborative effort of the Anti-Defamation League (ADL), National Chair, Barbara Balser and ... sites that include hate propaganda from the National Alliance and David Duke “If you are a teacher or student, I hope you will take a stand for right and wrong and use this information to enlighten ... 15 The National Alliance Web site features transcripts from a weekly anti-Semitic radio broadcast, online access to many articles from the group’s National Vanguard magazine, and a catalog of...

Ngày tải lên: 06/03/2014, 21:20

63 1,4K 0
Báo cáo khoa học: Purine nucleoside phosphorylases from hyperthermophilic Archaea require a CXC motif for stability and folding pot

Báo cáo khoa học: Purine nucleoside phosphorylases from hyperthermophilic Archaea require a CXC motif for stability and folding pot

... folding catalysts (reactivation assay) The catalytic activity of (A) SsMTAPII and SsMTAPIIC259S ⁄ C261S and (B) PfPNP and PfPNPC254S ⁄ C256S was then measured under standard assay conditions The activity ... was analyzed by catalytic activity measurements performed under standard conditions Reactivation assay of SsMTAPII, PfPNP and their CXC-lacking mutants The activity of SsCSC and PfCGC as catalysts ... concentration of mm was then added and A2 96, as a result of RNase-catalyzed cCMP hydrolysis, was monitored continuously for 210 at 30 °C The positive control was the reactivation of sRNaseA catalyzed...

Ngày tải lên: 07/03/2014, 00:20

7 497 0
Báo cáo khoa học: Characterization of the rice carotenoid cleavage dioxygenase 1 reveals a novel route for geranial biosynthesis ppt

Báo cáo khoa học: Characterization of the rice carotenoid cleavage dioxygenase 1 reveals a novel route for geranial biosynthesis ppt

... Journal compilation ª 2008 FEBS No claim to original German government works 743 A novel route for geranial formation A Ilg et al to the peak area of the internal standard, which was quantified at ... revealed the C7¢–C8¢ double bond of linear and monocyclic carotenoids to be an additional novel cleavage site of OsCCD1, leading to geranial and indicating a novel plant route for the formation ... medium for 30 For HPLC analyses, cells were harvested after h, and carotenoids were extracted and processed as described above Analytical methods For HPLC analyses, a Waters system equipped with a...

Ngày tải lên: 07/03/2014, 03:20

12 498 0
Báo cáo khoa học: The Vps4 C-terminal helix is a critical determinant for assembly and ATPase activity and has elements conserved in other members of the meiotic clade of AAA ATPases pdf

Báo cáo khoa học: The Vps4 C-terminal helix is a critical determinant for assembly and ATPase activity and has elements conserved in other members of the meiotic clade of AAA ATPases pdf

... ATCCTTTATGGTGAGATCAGCTTCAATATCCGTCCA TTAAAGGCTATCAAATCGCAAGAACAGTTCACTAGA TCTAGTGAACTGTTCTTGCGATTTGATAGCCTTTAA GAAGCAAGAACAGTTCACTTAGTCAATTGATTAACGTG CACGTTAATCAATTGACTAAGTGAACTGTTCTTGCTTC Table Yeast ... membrane was from Millipore (Bedford, MA, USA) Goat polyclonal anti-(yeast Vps4p) IgG was from Santa Cruz Biotechnology (Santa Cruz, CA, USA) and rabbit polyclonal anti-(carboxypeptidase Y) and anti-calmodulin ... Francisco, CA, USA) Horseradish peroxidaseconjugated goat anti-(mouse IgG) and gel-filtration standards were from Bio-Rad Laboratories (Hercules, CA, USA) Penta His mAb and Ni-NTA agarose were from Qiagen...

Ngày tải lên: 07/03/2014, 05:20

23 493 0
w