a no overall agenda the coherence of constitutional reform

... be a signal that the charter change initiative has not been relegated to the dustbin With this new mandate to push the constitutional reform agenda even beyond the Bayanihan Federalism draft, there ... though neither the Senate nor the House of Representatives have classified constitutional reform as a priority For the moment therefore, the charter change aspiration of the Duterte administration ... principle of separation of powers or the system of checks-and-balances There is also revision if the change alters the substantial entirety of the constitution, as when the change affects substantial

Ngày tải lên: 17/01/2021, 11:29

... phase velocity: The velocity of a point of constant phase on a single frequency wave plane wave: A wave in which the wave fronts are planar, E and H have constant values in the planes of the wave ... vectors and vector notation A scalar is a quantity that has magnitude only In contrast to this, a vector is a quantity that has magnitude and direction A familiar example of a vector quantity is the ... vectors A and B is defined as where C is the vector along the diagonal of the parallelogram shown in Figure 2.2 The negative of a vector A is defined as a vector having the same magnitude as A, but

Ngày tải lên: 20/09/2017, 21:46

... to place the country and its economy at the heart of the global economy and enhance its standing across a wide range of primary, manufacturing and service sectors At the same time, Industrial Revolution ... indicators. Big data makes it easier to collect and analyze data, so that there can be a basis to support and reduce discrimination against vulnerable groups. New technology may limit access to the ... and guarantee (Article 3) all fundamental human rights for everyone 5 Such constitutional recognition of human rights standards has created a legal foundation for further codification of human

Ngày tải lên: 28/01/2021, 20:45

... that must be maintained. Buổi 4 Comparing EVFTA, CPTPP and Law on Investment Trang 6Transfer ARTICLE 2.8 Transfer Each Party shall permit all delay, and at the market rate of exchange applicable ... Most-Favoured-1 Each Party shall accord to investors of another Party treatment no less favourable than that it accords, in like circumstances, to investors of any other Party or of any non-Party with ... capital to carry out business activities The investor is the organization that owns the capital or is assigned on behalf of the capital owner or the borrowing organization to directly manage the

Ngày tải lên: 14/04/2024, 11:28

... broad-based Financial Transactions Tax (FTT)—levied on the value of a wide range of financial transactions—and a Financial Activities Tax (FAT)—levied on the sum of the wages and profits of financial institutions ... problems affecting private financial markets that create an economic rationale for multilateral development banks (MDBs) and for other types of public financial flows Grant-based financing for adaptation ... private leverage factors can vary considerably according to the type of public financing that is deployed, the sector, the novelty of the technology and the level of informational and other barriers

Ngày tải lên: 06/03/2014, 08:21

... 5¢-TCCCCAGATGATGCCTTTGTT-3¢; ATP synthase subunit b: CCTTCTGCTGTGGGCTATCA-3¢ and 5¢-TCAAGTCATCAGCAGGCACA-3¢; ND5: 5¢-TAACCCC ACCCTACTAAACC-3¢ and 5¢-GATTATGGGCGTTGA TTAGTAG-3¢; b-globin: 5¢-CAACTTCATCCACGTTCA ... as fol-lows: ERRa: 5¢-AAGACAGCAGCCCCAGTGAA-3¢ and 5¢-ACACCCAGCACCAGCACCT-3¢; PRC: 5¢-CACTGG TTGACCCTGTTCCT-3¢ and 5¢-GTGTTTCAGGGCTTC TCTGC-3¢; Cyt c: 5¢-CCAGTGCCACACCGTTGAA-3¢ and 5¢-TCCCCAGATGATGCCTTTGTT-3¢; ... model, the inhibition of ERRa led to a significant decrease in the COX⁄ CS ratio as a result of the diminution of the respiratory chain capacity (COX activity), but not of the mitochondrial mass

Ngày tải lên: 06/03/2014, 09:22

... protein sequence Angle, the calculated angle between the helix axis and the plane of a model membrane ASA, accessible surface area +, the peptide has an adequate mean surface accessibility ‡ 30%. ... impair the ability of Iris to inhibit TNF-a by LPS-activated PBMC Anti-ep2 serum had an activity twice as low as that of anti-ep4 serum Because the different sera had the same antibody titer and ... Total number aa Number positive charge Number negative charge Number polar aa Angle () ASA Trang 6and E (104–114) and sheet 1A (117–121) (Fig 5).These domains are distinct from the RCL (amino acids

Ngày tải lên: 07/03/2014, 01:20

... initial adoption years Furthermore, many firms partially compensate managers based on reported accounting variables such as earnings As a result, the managers have an incentive to make an accounting ... on an industrial bond and the daily averages of the constant maturity yield on U.S Treasury Bond of comparable maturity on the issuance date If an industrial bond cannot be matched with a Treasury ... capitalized) All variables are normalized by net annual sales The change in variability is measured as the difference between the dispersion in software expenditures under capitalization and that under as-if

Ngày tải lên: 07/03/2014, 02:20

... used as a positive control to display omcA (lane 1) and omcB (lane 6) DNA standards are indicated at the left and right of the agarose gels (B) Visualization and separation of high molecular mass ... reductase assays were Table 2 Synthetic oligonucleotides used in this study. Oligonucleotide name Sequence (5¢- to 3¢) AAACGGTTCAATTTC AACGCACAAAAATCA Trang 10prepared as follows Anaerobically ... complement the omcA– mutant was shown using a pKNOCK-Cm-based omcA– mutant, instead of the pKNOCK-Km-based mutant that was applied in all other experiments Full complementation of either the omcA or

Ngày tải lên: 07/03/2014, 09:20

... (forward), 5¢-GGGGACAAGTTT GTACAAAAAAGCAGGCTTCGATGACGACGACAAG ATGAGCCCGATATGGAGTAATTGGCCT-3¢; and 3rev-Gulox (reverse), 5¢-GGGGACCACTTTGTACAAGAAA GCTGGGTCTCAGGGACCGAGAACGCGCCGGGTGT A-3¢ The PCR ... (ALO1) has a broader specificity and uses d-arabinono-1,4-lac-tone [16], l-galactono-1,4-lacd-arabinono-1,4-lac-tone and l-gulono-1,4-lac-tone [17] as substrates d-Arabinono-1,4-lacl-gulono-1,4-lac-tone ... Candida albicans D -arabinono-1,4-lactone oxidase (ALO), O93852; Neurospora crassa, Q7SGY1; Gibberella zeae, XP_388870; Arabidopsis thaliana L -galac-tono-1,4-lactone dehydrogenase (GLDH), At3g47930;

Ngày tải lên: 07/03/2014, 12:20

... of the Bechuanas Cattle are then slaughtered in honor of the dead chief, and over the grave a post iserected, to which the skulls and hair are attached as a trophy The bow, arrows, assagai, and ... 1794: CANOE BURIAL IN GROUND Saw Indian graves on the plateau of Independence Rock The Indians plant a stake on the right side of thehead of the deceased and bury them in a bark canoe Their children ... the death of a member of the household, the relatives begin a peculiar wailing, and the immediate members of the family take off their customary apparel and clothethemselves in rags and cut themselves

Ngày tải lên: 08/03/2014, 13:20

... to read what a visitor has entered into a form, perform a mathematical calculation based on the input, and provide feedback by displaying the results in another part of the form You may not find ... Each chapter will cover at least one new application If you want a preview of what you’ll learn, read the first page or so of each chapter What Are the Alternatives to JavaScript? Several other ... advent of Ajax Ajax is a concept that makes even a few professional programmers’ heads spin, but (not surprisingly) Dave manages to break down what Ajax is and what it isn’t, explains when it makes...

Ngày tải lên: 28/04/2014, 16:58

... JavaScript’s ability to read what a visitor has entered into a form, perform a mathematical calculation based on the input, and provide feedback by displaying the results in another part of the ... Each chapter will cover at least one new application If you want a preview of what you’ll learn, read the first page or so of each chapter What Are the Alternatives to JavaScript? Several other ... Java Although JavaScript and Java have similar names, they aren’t the same Netscape initially created JavaScript to provide interactivity for Web pages, and Sun Microsystems wrote Java as a general...

Ngày tải lên: 28/04/2014, 16:58

... MacDonald can be said to have a larger degree of dispersion of data around the mean than Max hamburger in those attributes Max hamburger had a larger standard deviation than MacDonald in these attributes“its ... that despite the fact that they are regular visitors of both restaurant, they did not take note of that particular attribute on their various visit and as a result had nothing to say about it An ... competitive advantage of the fast food restaurant The basic attribute of a fast food restaurant are also important for a fast food restaurant to excel because the strength of a brand commonly provide the...

Ngày tải lên: 24/09/2012, 17:19

... membrane hydration and avoidance of water flooding in the cathode catalyst layer and/or gas diffusion layer [2] Water management is related with air supply to the cathode and is one of the crucial ... near the cathode side area The maximum stress appears in the cathode side surface of the membrane, implying that major heat generation takes place near this region It can be seen also that the ... mechanical, thermal, and electrical contact between the central parts of the gas diffusion backing and Membrane-Electrode-Assembly (MEA) 2.2 Model equations 2.2.1 Air and fuel gas flow In natural...

Ngày tải lên: 05/09/2013, 14:58

... is the computer, with email notifications and other notifications of all kinds Then there’s the addicting lure of the browser, which contains not only an endless amount of reading material that ... facts — what harm has actually been caused so far? Try to a short test — an hour, a day, a few days, a week — and see what the results are In most cases the actual harm will be much less than ... half a day or a day — something manageable Do it once a week, and gradually expand the time you spend on the cleanse Reducing the Stream If you’ve done the cleanse, you now know the value of disconnecting,...

Ngày tải lên: 05/01/2014, 15:25

... and tools The knowledge management strategy developed at Irizar At Irizar, it is understood that the objective of KM is the promotion of innovation and the capacity of the organization to transform ... with their work The results are valued on a Likert scale of to for the different items Over the last few years, the average satisfaction index—calculated as the average of the values given to each ... knowledge of the environment, markets and customers The second fundamental aspect in the Irizar strategy was that of shared leadership The idea that the best organizations not depend on great...

Ngày tải lên: 24/01/2014, 00:20

... calculated as 82 It is unclear, but Fabiani et al (1996) and Fabiani et al (2000) appear to report the same participants Karwautz at al (2008) and Wagner et al (2008) report the same participants, ... protocol by Mitrofan, Paul and Spencer (2008) and adapted for this review, including the introduction of a numerical numbering system to aid data analysis As such, a score of denotes no available evidence ... in remainder of study (Phase 2) Parents assessed same dimensions on a parent version of questionnaire, as well as questions about general health Aged 2-4 yrs at diagnosis Diagnosed via mass screening...

Ngày tải lên: 12/02/2014, 12:20

... diseases” I STATE OF PLAY AT EUROPEAN LEVEL I.1 Unhealthy diets and lack of physical activity are the leading causes of avoidable illness and premature death in Europe, and the rising prevalence ... socio-economic groups be addressed? V.8 V.8.1 A coherent and comprehensive approach aimed at making the healthy choices available, affordable and attractive involves taking account of mainstreaming ... theoretically preventable cause of cancer Consumption of adequate amounts of fruits and vegetables, and physical activity, appear to be protective against certain cancers Body weight and physical inactivity...

Ngày tải lên: 14/02/2014, 13:20

... was America The role of World War I and the breakdown of the classical gold standard was taken over by the Cold War and the breakdown of the Bretton Woods System The latter’s replacement by a ... bonds, the U.S corporate bond market was several magnitudes larger than that of any other country It was no accident of history, then, that Moody, the originator of the bond-rating agency, was an American, ... slowly and then gathered steam as the early entrants became larger and new entrants appeared Such parallels between the two periods of agency expansion suggest to a historian that similar forces may...

Ngày tải lên: 16/02/2014, 03:20