a new type of visitor

Recruitment process outsourcing   a new type of service provider

Recruitment process outsourcing a new type of service provider

... Model of Human Resource Strategy that has competitive advantages in change management (Kalyani and Shahoo, 2011) 4 Modified Miaoulis et al (2008) stages of recruitment 5 Theoretical framework applied ... of categorization, secondary tools have to do with management of CV, career fairs and niche information whereas auxiliary tools included newsletter Generally it appears that organisations can ... The operational side is a set of goals related to detailed process that does not necessarily to add extra value to the process but are still crucial An example of this in the case of a payroll

Ngày tải lên: 26/04/2020, 22:01

116 21 0
How swelling debts give rise to a new type of politics in vietnam

How swelling debts give rise to a new type of politics in vietnam

... growth equals a rapid accumulation of debts State media reported that the amount of NPLs started stacking up from 2007 but only Trang 17on the ratio of NPLs against outstanding loans at banks, but ... case of incomplete rural credit markets, Stampini & Davis (2009) show that participation in non-agricultural labor may help relax credit constraints and provide cash for market purchases of ... access to credit Where informal and semi-formal lenders lead Rural credit Official data show that 65.49% of Vietnam’s population of nearly 93 million live in the rural areas and depend on agriculture

Ngày tải lên: 29/07/2022, 11:04

34 1 0
extensive testing and comparison of a new type of target for use in engineering surveying

extensive testing and comparison of a new type of target for use in engineering surveying

... of the assumed and measurement accuracy achieved The a priori standard deviation was selected as a value of 1 The a posteriori standard deviation reached a value of 0.94 after the network adjustment, ... comparison of the spatial coordinates. Type of target collimator (rotated)Target with Target with collimator (non-rotated) Reflective sheet Tab 4 Standard deviations calculated from a comparison of ... in Tab 3 for comparing the coordinates of the spatial variations in Tab 4 for a comparison of the lengths Trang 8According to the size of the standard deviations in Tables 3 and 4, it can be argued

Ngày tải lên: 24/11/2022, 17:56

12 2 0
Beyond the particular case of circuits with geometrically distributed components for approximation of fractional order models: Application to a new class of model for power law type long

Beyond the particular case of circuits with geometrically distributed components for approximation of fractional order models: Application to a new class of model for power law type long

... distributions (an infinity exist) of parameters that also lead to the same kind of behaviour As a Cauer type network can be obtained through the discretisation of a heat equation, Sec-tion ‘Heat equaSec-tion ... diagrams of the approximation Hað Þ obtained by discreti-s sation of integral(38)and change of variable(37) are shown in Fig 6 They are compared with the Bode diagrams obtained with change of variable ... comparison reveals that the two changes of variable are of equivalent quality with the same com-plexity (N¼ 10) As an infinity of changes of variable can be proposed, an infinity of Foster type

Ngày tải lên: 27/09/2020, 15:03

13 23 0
Báo cáo khoa học: MicroRNA-373, a new regulator of protein phosphatase 6, functions as an oncogene in hepatocellular carcinoma pdf

Báo cáo khoa học: MicroRNA-373, a new regulator of protein phosphatase 6, functions as an oncogene in hepatocellular carcinoma pdf

... quantity of b-actin in the same sample Table 1 The oligonucleotides used in this work. TCAAATTACTTACAAGTTTTTTGAATTCTCGAGA TGATCTCTTGAACAAATTACTTACACAAAGAG Trang 10Western blotHCC cells were transfected ... acquisition and analysis software was used to quan-tify band intensities Antibodies were purchased from Tian-jin Saier Biotech and Sigma-Aldrich Statistical analysis Data are expressed as mean ... phosphatase 6 catalytic subunit; SD, standard deviation; shRNA, small hairpin RNA; siRNA, small interfering RNA. Trang 2are important for target site recognition, and they havebeen designated as

Ngày tải lên: 14/03/2014, 23:20

11 401 0
13C–18O bonds in carbonate minerals: A new kind of paleothermometer ppt

13C–18O bonds in carbonate minerals: A new kind of paleothermometer ppt

... IAEA) and three intra-laboratory calcite standards, MARJ-1, MZ carbonate and Sigma-carb Two of the standards (NBS-19 and MARJ-1) were purified from Italian Carrara marbles that were metamor-phosed ... MAR-J1, MZ carbonate and Sigma-carb standards made between Janu-ary, 2004 and April, 2005 Each data point represents the average of between 1 and 10 analyses of the gas from a sin-gle acid extraction ... Trang 1Prosenjit Ghosh a,*, Jess Adkins a, Hagit Affek a, Brian Balta a, Weifu Guo a, Edwin A Schauble b, Dan Schrag c, John M Eiler a a Division of Geological and Planetary Sciences, California

Ngày tải lên: 22/03/2014, 18:20

18 474 0
Đề tài " A new application of random matrices: Ext(C red(F2)) is not a group " ppt

Đề tài " A new application of random matrices: Ext(C red(F2)) is not a group " ppt

... unital nuclear C ∗-algebra and by Voiculescu [V1], Ext(A) is a unital semi-group for all separable unital C ∗-algebras A Anderson [An] provided in 1978 the first example of a unital C ∗-algebraA ... first example of a C ∗-algebra A for which Ext(A) is not a group. 1 Introduction A random matrix X is a matrix whose entries are real or complex dom variables on a probability space (Ω, F, P ) As ... consisting of a unital C ∗-algebra B and a state τ on B. b) A family of elements (a i)i ∈I in a C ∗-probability space (B, τ) is free if for all n ∈ N and all polynomials p1, , p n ∈ C[X], one has

Ngày tải lên: 22/03/2014, 20:20

66 380 0
Đề tài " A new construction of the moonshine vertex operator algebra over the real number field " pot

Đề tài " A new construction of the moonshine vertex operator algebra over the real number field " pot

... Annals of Mathematics A new construction of the moonshine vertex operator algebra over the real number field By Masahiko Miyamoto Annals of Mathematics, 159 (2004), 535–596 A new ... [DMZ] that V  is a framed VOA of rank 24. Our main purpose in this paper is to reconstruct V  as a framed VOA. Another important example of framed VOAs is a code VOA M D for an even linear code ... {e 1 , ,e n } of conformal vectors “a coordinate set.” We note that a VOA V of rank n 2 is a framed VOA if and only if V is a VOA containing L( 1 2 , 0) ⊗n as a sub VOA with the same Virasoro element.

Ngày tải lên: 28/03/2014, 22:20

63 423 0
Báo cáo khoa học: Methanoferrodoxin represents a new class of superoxide reductase containing an iron–sulfur cluster docx

Báo cáo khoa học: Methanoferrodoxin represents a new class of superoxide reductase containing an iron–sulfur cluster docx

... 5¢-ATGGTAGGTCTCAAATGATAGGAA ATGAAGAAAAAATAAATAAGC-3¢; and mm0632rev, 5¢-ATGGTAGGTCTCAGCGCTGGCTTTCCAGACGCA TTTTTTGC-3¢. The gene mm0632 was cloned via BsaI restriction sites in plasmid pASK-IBA3 (IBA GmbH, Go ¨ ttingen, ... [7]. Methanosarcina mazei is one of the methanogenic archaeons, which are characterized by the ability to generate methane as the major end product of energy metabolism [8]. Many Methanosarcina strains ... structure of a monofunctional catalase from Methanosarcina barkeri. Arch Microbiol 171, 317–323. 39 Brioukhanov A, Netrusov A, Sordel M, Thauer RK & Shima S (2000) Protection of Methanosarcina barkeri against

Ngày tải lên: 28/03/2014, 23:20

10 541 0
WORLD INVESTMENT REPORT 2012 Towards a New GeNeraTioN of iNvesTmeNT Policies potx

WORLD INVESTMENT REPORT 2012 Towards a New GeNeraTioN of iNvesTmeNT Policies potx

... Dip and Ganu Subramanian Production and dissemination of WIR12 was supported by Elisabeth Anodeau-Mareschal, Severine Excoffier, Rosalina Goyena, Natalia Meramo-Bachayani and Katia Vieu The manuscript ... Clements, Hamed El Kady, Noelia Garcia Nebra, Ariel Ivanier, Elif Karakas, Abraham Negash, Faraz Rojid, Diana Rosert, Claudia Salgado, John Sasuya, Youngjun Yoo and intern Cree Jones also contributed ... economies of the Association of South-East Asian Nations (ASEAN) – Brunei Darussalam, Indonesia, Malaysia and Singapore – saw a considerable rise FDI flows to China also reached a record level of $124

Ngày tải lên: 30/03/2014, 12:20

239 484 0
Báo cáo Y học: Hemocyanin from the keyhole limpet Megathura crenulata (KLH) carries a novel type of N-glycans with Gal(b1–6)Man-motifs doc

Báo cáo Y học: Hemocyanin from the keyhole limpet Megathura crenulata (KLH) carries a novel type of N-glycans with Gal(b1–6)Man-motifs doc

... Peptide-N4-(N-acetyl-b-glucosaminyl)asparagine amidase A from almond (PNGase A) was from Seikagaku (Tokyo, Japan) and b-galactosidase from jackbeans was obtained from Glyco (Upper Herford, UK) Tryptic digestion of KLH ... PNGaseA-PA and Hyd(HFA)-PA, respect-ively Analytical anion-exchange HPLC of the pyridyl-aminated oligosaccharide pools demonstrated the absence of negatively charged oligosaccharide derivatives ... with an excitation wavelength of 320 nm and an emission wavelength of 400 nm MALDI-TOF-MS MALDI-TOF-MS data were obtained using a Vision 2000 apparatus (Finnigan MAT, Bremen, Germany), operating

Ngày tải lên: 31/03/2014, 08:20

15 482 0
Buying Trances: A New Psychology of Sales and Marketing

Buying Trances: A New Psychology of Sales and Marketing

... is a 10-year rule stating that virtually anyone can be-come a genius—or at least a superior performer—in a niche if they apply themselves in that area for a decade As I think about how I became ... production, and health Had I talked aboutany of those subjects, he would have leaned forward andasked a lot of questions He wasn’t in a Buying Trance Hiswife was Your readers, prospects, customers, and ... tecting Against Advertisers, Marketers and Big Business paganda, says we are exposed to more than 3,000 Pro-commercial messages a day Some of my other research revealed the following: The average

Ngày tải lên: 07/04/2014, 11:17

238 650 3
scientific american   -  1995 08  -  a new theory of aids latency

scientific american - 1995 08 - a new theory of aids latency

... through a vessel containing an amalgam of sodi- um separated by a glass partition from mercury. After a while the amalgam was found to have lost a certain amount of its weight, while the same amount ... provides an ideal chronicle Neumann of the University of North of climate and sea-level changes... physiological abnormalities causing apnea Largely as a result of this paper, the apnea hypothesis ... of Oklahoma usually form within larger masses of rotating air known as mesocyclones In 1953 a mesocyclone appeared on a radar screen at Urbana, Ill., as a hookshaped appendage on the

Ngày tải lên: 12/05/2014, 15:01

89 595 0
a new deal of welfare empowering people to work

a new deal of welfare empowering people to work

... deterred from participating in activities such as voluntary work Their fear of participating was twofold: they were afraid that any payment of expenses would be taken into account as earnings and cost ... a day or may have some days when they cannot do anything Any work done is sporadic and dependent upon the often fluctuating health status of the individual on any given day Such individuals are ... work if that is a suitable and realistic route SCIE has recently launched a review of research and existing practice of health and social care services in supporting parents with mental health problems

Ngày tải lên: 26/05/2014, 23:26

12 322 0
context-aware pervasive systems architectures for a new breed of applications

context-aware pervasive systems architectures for a new breed of applications

... Andiwijaya Sumartono, and SuHui Chuah on the CALMA agent-based Web service framework; and AmirPadovitz and Arkady Zaslavsky on context-aware messaging and contextmodeling Suan Khai Chong and Shonali ... pervasive computing is a study of pervasive computer systems (a combination of hardware and software)13 that are aware of context and can automatically adapt and respond to such context Context awareness ... primacy of the situation abstraction and has noted that an agent(e.g., a human) is able to individuate a situation According to Devlin(1991), a situation is a “structured part of reality that

Ngày tải lên: 01/06/2014, 00:18

240 247 0
walter russell - a new concept of the universe

walter russell - a new concept of the universe

... otlrer and v:eight clisapPedrs If weiqht were a fixed attribute of matter it would be unchaigeable lt varies howevef as the potentials of masses otrt of "balance vary A man weighs less as he ascends ... process of polarization lakes place *ltll increasing intensil];for one'half of everY cycle Nhelher ol one breaih, the cycle of a da! a yeat or a lifetime' A man of fortl uill hare rcached his ... ÆTHERFORCE Trang 28many stages between the appearance and disappearance of what the senses interpret as obiective The astronomer should likewise think that way of his suns and sta$.lt should be easierforthe

Ngày tải lên: 04/06/2014, 12:38

98 569 0
báo cáo hóa học:" Human fallopian tube: a new source of multipotent adult mesenchymal stem cells discarded in surgical procedures" potx

báo cáo hóa học:" Human fallopian tube: a new source of multipotent adult mesenchymal stem cells discarded in surgical procedures" potx

... Paulo SP, CEP: 01239-040, Brazil and 3 Celula Mater, São Paulo, Brazil Al Gabriel Monteiro da Silva, n° 802 São Paulo SP, CEP: 01442-000, Brazil Email: Tatiana Jazedje - tatiana@ib.usp.br; Paulo ... karyotype analysis and pictures; Marta Cánovas for technical support; Trang 9Dr Mariz Vainzof for WB analysis and suggestions; Dr Irina Kerkis for anti-bodies supplying; Marcos Valadares and Maria Denise ... identification, and character-ization of potential sources of adult stem cells [7,10,12-15], the aim of this study was to isolate, expand, charac-terize and assess the differentiation potential of

Ngày tải lên: 18/06/2014, 15:20

10 456 0
Báo cáo khoa học: Characterization and structural modeling of a new type of thermostable esterase from Thermotoga maritima ppt

Báo cáo khoa học: Characterization and structural modeling of a new type of thermostable esterase from Thermotoga maritima ppt

... 5¢-CA FEBS Journal 274 (2007) 2832–2842 ª 2007 The Authors Journal compilation ª 2007 FEBS M Levisson et al GTCACCTGGTAGTTACTGCCGCCGAAG-3¢, 5¢-CGAC GATCTCAATAACTTGATGATTTCAGG-3¢ and 5¢-CTC CTGAAATCATCAAGTTATTGAGATCGTCG-3¢, ... PAGE in duplicate One gel was stained with Coomassie Brilliant Blue (A) and the other was stained for activity using a- naphtyl acetate after renaturation (B) Lane M relative molecular mass standards; ... et al (2005) CDD: a Conserved Domain Database for protein classification Nucl Acids Res 33, 192–196 34 Kanehisa M, Goto S, Kawashima S & Nakaya A (2002) The KEGG databases at GenomeNet Nucl Acids...

Ngày tải lên: 23/03/2014, 09:20

11 467 0
Tài liệu Báo cáo khoa học: Crystal structure of the catalytic domain of DESC1, a new member of the type II transmembrane serine proteinase family pptx

Tài liệu Báo cáo khoa học: Crystal structure of the catalytic domain of DESC1, a new member of the type II transmembrane serine proteinase family pptx

... structure of the catalytic domain of DESC1 Scheme Domain organization of human DESC1 membrane region The extracellular part of DESC1 consists of a 120-amino acid SEA domain followed by the C-terminal ... sequence of DESC1 The reactive loop sequences are Val-Ser-Ala-ArgflMet-Ala-Pro and Phe-Thr-Phe-ArgflSer-Ala-Arg for PAI-1 and PCI, respectively [6] By contrast, the reactive site loops of a1 -antichymotrypsin ... that the SEA domain functions by orienting the active site cleft of DESC1 toward plasma and ⁄ or extracellular spaces and away from the cell surface and ⁄ or the extracellular matrix The SEA...

Ngày tải lên: 19/02/2014, 00:20

13 588 0
Tài liệu Toward a New Literacy of Cooperation in Business MANAGING DILEMMAS IN THE 21ST CENTURY pdf

Tài liệu Toward a New Literacy of Cooperation in Business MANAGING DILEMMAS IN THE 21ST CENTURY pdf

... group an action or reaction among actors that is triggered by an CATALYSIS outside agent a very small amount of catalytic agent can facilitate a very large-scale reaction If we think of tools and ... go hand-in-hand, posing a choice at every juncture, a choice that arises because of a basic dilemma—traditionally framed as a social dilemma Social Dilemmas: The Problem of the One and the Many ... Kollock, author of Social Dilemmas: The Anatomy of Cooperation, explains that, Social dilemmas are situations in which individual rationality leads to collective irrationality That is, individual rational...

Ngày tải lên: 18/02/2014, 00:20

67 895 0
w