a new solution for protein comparison

DSpace at VNU: Solution structure of the squash trypsin inhibitor MCoTI-II. A new family for cyclic knottins

DSpace at VNU: Solution structure of the squash trypsin inhibitor MCoTI-II. A new family for cyclic knottins

... display no significant antibacterial activity, whereas circulins and kalata B1 do A number of small, stable disulfide-rich proteins have been found in plants and animals The corresponding scaffolds ... constraints used is available as Supporting Information, and the statistics for constraint violations and for molecular mechanics energies are shown in Table 1 The program DYANA (35) was used to compute ... specifically against Gram-positive bacteria, whereas circulin B and cyclopsy-chotride A displayed activity against both Gram-positive and Gram-negative bacteria These cyclic peptides also displayed

Ngày tải lên: 16/12/2017, 02:50

11 78 0
A new solution method for a mean risk mixed integer nonlinear program in transportation network protection

A new solution method for a mean risk mixed integer nonlinear program in transportation network protection

... h,k a : the ratio of post-disaster arc capacity to the full arc capacity, with each k ∈ K and for every aA h ∈ H, θ h,k a ∈ (0, 1] When a disaster occurs, the post-disaster capacity of arc a ... the travel time in case of the free-flow-rate of arc a. Trang 4We use some variables as follows:u h a : the binary variable, takes a value of 1 if using strategy h for arc a and 0 otherwise, for ... rs,k a for all a ∈ A; q rs,k : the travel demand is not satisfied for the O-D pair (r, s). The model allows for post-disaster travel demand that are not satisfied for a variety of reasons, such as

Ngày tải lên: 17/03/2021, 17:27

13 6 0
Báo cáo khoa học: "Parsing the Internal Structure of Words: A New Paradigm for Chinese Word Segmentation" doc

Báo cáo khoa học: "Parsing the Internal Structure of Words: A New Paradigm for Chinese Word Segmentation" doc

... Linguistics. Canasai Kruengkrai, Kiyotaka Uchimoto, Jun’ichi Kazama, Yiou Wang, Kentaro Torisawa, and Hitoshi Isahara. 2009. An error-driven word-character hybrid model for joint Chinese word segmentation ... HLT-NAACL 2004: Main Proceedings, pages 249–256, Boston, Massachusetts, USA, May 2 - May 7. Association for Computational Linguistics. Mengqiu Wang, Kenji Sagae, and Teruko Mitamura. 2006. A fast, ... Language Processing, pages 133–143, Sapporo, Japan, July. Association for Computational Linguis- tics. Richard Sproat, William Gale, Chilin Shih, and Nancy Chang. 1996. A stochastic finite-state

Ngày tải lên: 17/03/2014, 00:20

10 476 0
Báo cáo khoa học: A new paradigm for oxygen binding involving two types of ab contacts docx

Báo cáo khoa học: A new paradigm for oxygen binding involving two types of ab contacts docx

... the rate constants k A 0 and k B 0 .In fact, the catalytic proton enhances the rate dramatically both in the separated a and b chains, by a factor of more than 10 6 per mole for state A and state ... experimental data with the aid of a computer. As a result, the pH-dependence curves for the autoxidation rate of the separated a and b chains have been analysed completely in terms of an Ôacid-catalysed ... haem oxidation, probable explanations are as follows. At basic pH, the separated a and b chains are both quite susceptible to autoxidation. Each haem pocket seems to be consid- erably open to allow easier

Ngày tải lên: 17/03/2014, 10:20

11 371 0
Team Risk Management: A New Model for Customer- Supplier Relationships doc

Team Risk Management: A New Model for Customer- Supplier Relationships doc

... Integrated management • Making risk management an integral and vital part of project management • Adapting risk management methods and tools to a project’s infrastructure and culture Trang 12SEI ... 8].Kloman summarized the meaning of risk management in the context of a number of different disciplines in an article for Risk Analysis: What is risk management? To many social analysts, politicians, ... administrators itmay mean ‘quality assurance.’ To safety professionals it is reducingaccidents and injuries [Kloman 90, p 20] Kloman Paraphrase of Rowe Risk management is a discipline for living

Ngày tải lên: 23/03/2014, 23:21

30 522 0
Báo cáo khoa học: A new highly toxic protein isolated from the death cap Amanita phalloides is an L-amino acid oxidase pdf

Báo cáo khoa học: A new highly toxic protein isolated from the death cap Amanita phalloides is an L-amino acid oxidase pdf

... (2009) Purification and character-ization of a new L-amino acid oxidase from Daboia 22 Zhang L & Wu WT (2008) Isolation and characteriza-tion of ACTX-6: a cytotoxic l-amino acid oxidase from 554–563 ... they were added at Statistical analysis All experiments were repeated at least three times with minimum three parallels The standard deviation was calculated, and the statistical significance of ... human lung carcinoma A549 and human breast carcinoma MCF-7 cells) [16] The proapoptotic action of toxophallin, as revealed in a DNA-laddering bio-assay, was demonstrated by the results of a cytomorphological

Ngày tải lên: 29/03/2014, 08:20

10 480 0
nuallain - the search for mind - a new foundation for cognitive science (cromwell, 2002)

nuallain - the search for mind - a new foundation for cognitive science (cromwell, 2002)

... (Ed.), Natural language processing New York: Algorithmics Woods, W A (1980) Cascaded ATN grammars American Journal of Computational Linguistics 1, 1-12 Woods, W A (1984) Natural language communication ... of natural language and vision, Seattle, WA O Nuallain, S., & Smith, A (1994) An investigation into the common semantics of language and vision Paper presented at the AAAI spring symposium, March ... Strategies in NLP Hillsdale, NJ: Erlbaum 271 The Search for Mind Smith, A., B Farley and Ó Nualláin, S (1996) Visualization of natural language In Gretal (Ed.) Natural Language Processing and

Ngày tải lên: 03/04/2014, 12:07

288 259 0
RBF Neurals Networks and a new algorithm for training RBF networks

RBF Neurals Networks and a new algorithm for training RBF networks

... regression method, we create a new set of data with equally spaced nodes in a given web defined in the range of parameters of original unequally spaced nodes Each value of new equally spaced nodes is noise ... HDH-1phase algorithm with the input data is new equally spaced nodes (circles) and the reduction value of each node Trang 52.3 The approximately multivariable function problemApproximating multivariable ... Trang 11 Summary 2 Introduction about function regression 3 RBF Neurals Networks and a new algorithm for training RBF networks 4 Experiment 5 Conclusion Trang 21 SUMMARY Gaussian radial basis

Ngày tải lên: 12/04/2014, 15:40

22 271 0
Bacillus thuringiensis   a new perspective for an induced protection to coffee leaf rust

Bacillus thuringiensis a new perspective for an induced protection to coffee leaf rust

... Leaf Rust* DAGMAR S. RovERATn*'% ANA REGINA R. TEIXEIRA and WALKYRIA B. C. MORAES Authors' address: Se^ao de Bioquimica Fitopatologica, Instituto Biologico, CP. 7119, 0105! Sao Paulo, ... 5 semanas. A prote9ao observada foi sistemica. O indice de prote^ao foi determinado peia redugao do numerc medio de lesoes por folha. Uma redu^ao no tamanho das lesoes nas folhas tratadas, bem ... induced leaf (Table 3). The systemic effect also spread laterally from one leaf of the pair to the other leaf of the same pair (Table 3), and in the same leaf from the adaxial to the abaxial surface

Ngày tải lên: 05/05/2014, 08:45

12 423 0
Health and Quality of Life Outcomes BioMed Central Research Open Access A new instrument for ppt

Health and Quality of Life Outcomes BioMed Central Research Open Access A new instrument for ppt

... develop and validate a scale that could be administered to anticoagulation patients generally; that is, across indication for anticoagulation and across mod-els of anticoagulation management ... ingela.wiklund@astrazeneca.com; Ewa Hedner - ewa.hedner@astrazeneca.com; Gail Wygant - gail.wygant@astrazeneca.com; Ole Hauch - ole.hauch@astrazeneca.com; Cheryl Beadle Marple - cheryl.marple@astrazeneca.com; ... patients with mechanical heart valves, valvular heart dis-ease, myocardial infarction, and atrial fibrillation [1] It is often intended that anticoagulation be maintained over the long term; for

Ngày tải lên: 20/06/2014, 15:20

11 365 0
báo cáo hóa học: " TCP NCE: A unified solution for non-congestion events to improve the performance of TCP over wireless networks" docx

báo cáo hóa học: " TCP NCE: A unified solution for non-congestion events to improve the performance of TCP over wireless networks" docx

... ack has congestion warning mark or not. If it has mark, TCP NewJersey assumes that the loss is caused by network congestion and pro ceeds as TCP NewReno [15] after estimating the available bandwidth ... mechanism to adjust dupthresh dynamically. The author utilizes a combined cost function for retransmission timeouts (RTO) and false fast retransmissions to adapt the false fast retransmit avoidance ... cwnd’sworth of data. T hird, for the es timations of RTT and RTO the authors proposed an idea to correct the sampling bias against long RTT samples. Compared to Blanton-All- man algorithm, RR TCP

Ngày tải lên: 21/06/2014, 02:20

20 563 0
Báo cáo hóa học: " Research Article AWPP: A New Scheme for Wireless Access Control Proportional to Traffic Priority and Rate" pdf

Báo cáo hóa học: " Research Article AWPP: A New Scheme for Wireless Access Control Proportional to Traffic Priority and Rate" pdf

... that can be used by HCCA: t AP STA A Poll TA DA NO Poll t + tPOLL + tNO DELAY + 2tPROP DELAY t AP STA A (i) Polling a Station That Has No Packets for Transmission (Figure 1(a)) The AP polls a ... traffic load is represented in Figure 10 It can be seen that regarding MP traffic, performance degradation starts at significantly lower load in POAP than in AWPP HCCA exhibits a steady behavior to a limited ... destination station broadcasts a STATUS packet acting STA B tus Sta k) (ac t + tPOLL + tSTATUS Da (4) 2.3 The POAP Protocol POAP is a high-performance polling-based protocol that exploits the feedback

Ngày tải lên: 21/06/2014, 05:20

11 518 0
Báo cáo y học: "Cross-species cluster co-conservation: a new method for generating protein interaction networks" docx

Báo cáo y học: "Cross-species cluster co-conservation: a new method for generating protein interaction networks" docx

... fibrosis; P aeruginosa PAO1 was isolated from a wound [32] P aeruginosa is a versatile Gram-negative bacterium that also thrives in soil, marshes and coastal marine habitats, and on plant tissues ... the computational aspect Additional data files The following additional data are available with the online version of this paper Additional data file is a figure that shows the reliability of ... validate this method using named proteins where functional information was available While this is appropriate for method validation, the disadvantage is that there are problems with annotation...

Ngày tải lên: 14/08/2014, 08:20

13 389 0
optimization of protein and rna detection methodologies and a new approach for manipulating protein activity in living cells

optimization of protein and rna detection methodologies and a new approach for manipulating protein activity in living cells

... 5’PHOS-GAACCGGAGCCGCAGCACCCGGGGCAGCAAGGCATT 27 GGGAAGCTTGCCACCATGGGTGACTGGAGTGCCTTGGGGAAATTACTGG ACAAGG 28 AAAAGGTACCGACCGGTTGAACCGCAATCTCCAGGTCATCAG 29 ACCATGGCCGGATCCGCTCGGTGGTGCTGCCC 30 GGGCAGCACCACCGAGCGGATCCGGCCATGGT ... TTTTAAGCTTGCCACCATGGCCGGATCCTAAGCGGCCGCAGCAAGGGCGAGGAG CTG 10 CCCCATCGATCTCGAGTTACTTGTACAGCTCGTCCAT 11 ACCTACAGGTGGGGTCTTTCATTCCC 12 AGCTCGTTTAGTGAACCGTCAGATC 13 GACAAGCGGCCGCTTAAGAACCGC 14 AAACTCGAGTTAGCGGCCGCCCCTCCACATGCAG 15 AAAGCGGCCGCCAGAACCGCAGCACCCGGGGCA ... CCCAAGCTTGCCACCATGGTGAGCAAGGGCGAGGAG TTTGGATCCNNKNNKNNKTGCTGCCCCGGCTGCTGC TTTTGCGGCCGCCMNNMNNMNNGCAGCAGCCGGGGCAGCA AATACGACTCACTATAGGGA GTAATCCAGAGGTTGATTCTCGAGAAAA TTTTAAGCTTGCCACCATGGCCGGATCCTAAGCGGCCGCAGCAAGGGCGAGGAG...

Ngày tải lên: 13/11/2014, 10:46

144 311 0
A new solution approach for the inventory routing problem using vehicle routing problem constructive heuristic

A new solution approach for the inventory routing problem using vehicle routing problem constructive heuristic

... on each day Using these quantities as indications, the second phase then builds an actual delivery schedule for the next two days, using more accurate demand information, and taking into account ... by finding a feasible solution to the dual of a set-partitioning VRP formulation Branch-and-cut is another less investigated exact solution method In this approach, the linear relaxation of the ... capacitated vehicles Each customer faces a deterministic demand over a finite planning horizon, and has a finite capacity to keep local inventory The goal is to minimize system-wide transportation...

Ngày tải lên: 16/09/2015, 15:43

109 485 0
Báo cáo y học: "Rasburicase represents a new tool for hyperuricemia in tumor lysis syndrome and in gout Lisa Cammalleri and Mariano Malaguarnera"

Báo cáo y học: "Rasburicase represents a new tool for hyperuricemia in tumor lysis syndrome and in gout Lisa Cammalleri and Mariano Malaguarnera"

... hyperuricemia [21-24] Contemporary use of alkalinization, hydration and rasburicase at 0.10 mg/kg for 3-5 days maintains the same efficacy [25] Anyway, we may have favourable issues by changing the ... prevent and treat hyperuricemia include allopurinol and alkalinization, associated with an aggressive hydration Rasburicase presents various features that give it a more favourable profile than standard ... because each metabolic derangement is associated with remarkable clinical manifestations Hyperuricemia and hyperphosphatemia severely worsen renal functionality; hyperkalemia and hypocalcemia...

Ngày tải lên: 31/10/2012, 14:59

11 717 0
Tài liệu The Book Of Personal Transformation - How To Use Ancient Wisdom To Create A New Life For Yourself docx

Tài liệu The Book Of Personal Transformation - How To Use Ancient Wisdom To Create A New Life For Yourself docx

... lives AFFIRMATIONS Jeff Staniforth, the creator of Sculptor 3, an amazing software that can make affirmations work for anyone, has this to say about affirmations: “By definition, an affirmation ... poem like a mantra as often as I can remember: Thank you for the abundance, Thank you for the wealth; Thank you for all the happiness, Protections and Good Health Repeat this mantra consistently ... a certain prejudice towards certain people or race, try to make an extra effort to love them unconditionally For example, if you are biased against Muslims in general, make an extra effort to...

Ngày tải lên: 15/12/2013, 06:15

59 772 3
Tài liệu VIRTUAL REALITY - A NEW TECHNOLOGY FOR THE MECHANICAL ENGINEER docx

Tài liệu VIRTUAL REALITY - A NEW TECHNOLOGY FOR THE MECHANICAL ENGINEER docx

... component on a PC is that there are a wide variety of devices available for the PC platform, as opposed to the UNIX platform This also has an important practical advantage in that a much Fig 14.2 ... Virtual Reality Modeling Language (VRML) is a relative newcomer in the field of VR software It was originally conceptualized as a language for Internet-based VR applications but is gaining popularity ... used for VR applications Currently, all major UNIX workstation vendors have specific platforms targeted to the VR market These workstations usually have a enhanced graphics performance and specific...

Ngày tải lên: 23/01/2014, 07:20

10 636 1
Tài liệu A New Era for Conservation docx

Tài liệu A New Era for Conservation docx

... Upgrade, and Increase Monitoring, Data Analysis and Management; • Plan for and Adapt to Sea Level Rise; and • Identify and Fund Focused Climate Change Impacts and Adaptation Research and Analysis ... changes associated with climate change are already having a significant biological impact across a broad range of natural systems For example, across North America, plants are leafing out and ... the capacity of many organisms to adapt in this classical sense U.S natural resource managers and conservationists are accelerating their plans and actions for climate change adaptation, in large...

Ngày tải lên: 25/01/2014, 20:20

69 440 0
Tài liệu Dollar Cost Banding - A New Algorithm for Computing Inventory Levels for Army Supply Support Activities pdf

Tài liệu Dollar Cost Banding - A New Algorithm for Computing Inventory Levels for Army Supply Support Activities pdf

... Command ASB Aviation Support Battalion ASL Authorized Stockage List AVIM Aviation Intermediate Maintenance AVN Aviation AWCF Army Working Capital Fund CASCOM Combined Army Support Command CTASC Corps/Theater ... MR-1150 -A, 2002; Marygail K Brauner et al., Dollars and Sense: A Process Improvement Approach to Logistics Financial Management, Santa Monica, CA: RAND Corporation, MR-1131 -A, 2000; and Marygail ... parts that are unavailable at the SSA might not arrive for a week or more But despite the advantages of having parts available from the supporting SSA, Army inventory managers determining what to...

Ngày tải lên: 17/02/2014, 17:20

132 428 0
w