a new model for comprehensive caries prevention

... Johannes and Sundaresan [2007], and Fuijii and Takahahsi [2012] model collateralization via a cost-of-collateral instantaneous rate Piterbarg [2010] regards collateral as a regular asset and uses ... that may provide additional statistical and financial insights Swap rate is the fixed rate that sets the market value of a swap at initiation to zero ISDAFIX provides average mid-market swap rates ... year swap rate 4.3327% 4 year swap rate 4.3770% 5 year swap rate 4.4213% 6 year swap rate 4.4679% Trang 137 year swap rate 4.5120% 8 year swap rate 4.5561% 9 year swap rate 4.5952% 10 year swap

Ngày tải lên: 23/07/2020, 01:22

... the rating, because, unlike a corporation, a CDO is simply a brass plate on a wall Unfortunately, CDO quantitative analysts and the rating agencies did not take into account — partly because ... rest MACROPRUDENTIAL FINANCIAL REGULATION AND CYCLE - PROOF REGULATION Perhaps a starting point for fi nancial market regulators should be an tance that crashes and crises in markets are an inherent ... Remuneration in the Banking Industry 60 Conclusion 65CHAPTER 5 Bank Capital Safeguards: Additional Capital Buffers and CHAPTER 6 Conclusion 92 PART Two New Models for Banking and Investment 93 CHAPTER

Ngày tải lên: 03/04/2021, 10:38

... and as a means of developing model tasks for local assessments Such a system supports rather than undermines local assessment efforts At present, federal regulations require aggregated data at ... that form the framework for measurement are (1) financial outcomes, (2) internal business processes, (3) customer satisfaction, and (4) organizational innovation and learning Applying and adapting ... the assessment of that learning, teacher learning and evaluation, equity and access to learning for all, and the continuous improvement and renewal of the organization The Physical and Emotional

Ngày tải lên: 19/10/2022, 02:57

... Attendance Rates Attendance Average, 1st Marking Period Attendance Average, 2nd Marking Period Trang 88 While more data are necessary to draw a definitive conclusion, student proficiency data ... engineering and mathematical (STEM) academic programs Nanotechnology, or the study of material properties at the nanoscale, has led this revolution which has created the steady wave of new jobs and investments, ... These innovations have also created a need for a highly skilled and adaptable workforce, yet industry is having a difficult time in their search for highly qualified US candidates From private firms

Ngày tải lên: 23/10/2022, 01:32

... Bronx, New York, United States of America, 4 Department of Medicine, University of Alabama at Birmingham, Birmingham, Alabama, United States of America, 5 Birmingham Veterans Affairs Medical Center, ... human-specific internal primer sets for CD4 (59 primer: GTGGAGTTCAAAATAGACATCGTG, 39 primer: CAGCACCCACACCGCCTTCTCCCGCTT), CCR5 (59 primer: CACCTGCAGCTCTCATTTTCC, 39 primer: TTGTAGGGAGCCCAGAAGAG) and cyclin ... However, these humanized mouse models cannot take advantage of the wide array of available transgenic and gene-deleted mouse lines to apply Trang 2genetic approaches to investigate HIV-1 transmission

Ngày tải lên: 02/11/2022, 14:24

... efficacy: A new measure for evaluating block-diagonal forms in group technology   Adnan Mukattash a* , Nadia Dahmani a,b , Adnan Al-Bashir c and Ahmad Qamar c a Department of Industrial Management, ... block-diagonal form: The block-diagonal form in which all diagonal blocks contain ones and all off-diagonal blocks contain zeros (Kumar & Chandrasekhoran, 1990) Trang 3A Mukattash et al Sparsity ... 2 For other measures that are available in the literature see (Sarker & Mondal, 1999; Sarker & Khan, 2001, Sarker, 2001; Keeling et al., 2007, Agrawal et al., 2011, Kichun & Kwang-Il,

Ngày tải lên: 14/05/2020, 22:34

... status in a New Zealand context, and allowed us to develop and validate a statistical model for available demographic factors, in our local patient population Methods Patient data This population-based ... Phyu Sin Aye1* , Sandar Tin Tin1, Mark James McKeage2,3, Prashannata Khwaounjoo2, Alana Cavadino1and J Mark Elwood1 Abstract Background: Targeted treatment with Epidermal Growth Factor Receptor ... Māori and Pacific people Thus, we aimed to develop and validate a model based on the New Zealand Trang 3patient data to estimate the probability of EGFR muta-tions in patients with non-squamous

Ngày tải lên: 06/08/2020, 05:46

... (CAA) CCA, external carotid artery (ECA), CAA, superficial temporal artery (STA) and rostral auricular artery (RAA) lengths and calibers were recorded Angiosomes study In two heads, STA and ... facial animal models for VCA have been developed, from full face transplants 6 to subunit models, mainly regarding the auricle, in a few small 7 and large 8, 9 animals Subunit models indeed allow ... that a reliable auricular flap could be harvested on the single caudal auricular artery Therefore, we investigated the constitutive vascular anatomy and perfusion of the ear flap Finally, we applied

Ngày tải lên: 04/12/2022, 16:01

... Command ASB Aviation Support Battalion ASL Authorized Stockage List AVIM Aviation Intermediate Maintenance AVN Aviation AWCF Army Working Capital Fund CASCOM Combined Army Support Command CTASC ... parts that areunavailable at the supporting SSA might not arrive for a week ormore But despite the advantages of having parts available from themaintainer’s supporting SSA, Army inventory managers ... parts that are unavailable at the SSAmight not arrive for a week or more But despite the advantages ofhaving parts available from the supporting SSA, Army inventorymanagers determining what to

Ngày tải lên: 17/02/2014, 17:20

... 5¢-CTC GAGATGGATAAAGTTTTAAACAGAG-3¢ and LTA-1R, 5¢-TGAAGGCAAATCTCTGGAC-3¢ for the former, and LTA–M2F, 5¢-CAGCTGTTTTGCTTGAATTATG-3¢ and LTA–2R, 5¢-GAATTCATTATGTTTCAGGTTCA GGGG-3¢ for the latter The ... Trang 1culture of organ-specific blood vascular and lymphaticendothelial cells of the mouse Takashi Yamaguchi, Taeko Ichise, Osamu Iwata, Akiko Hori, Tomomi Adachi, Masaru Nakamura, Nobuaki ... endothelial hyaluronan receptor-1; MACS, magnetic-activated cell separation; MAPK, mitogen-activated protein kinase; PFA, paraformaldehyde; Prox-1, prospero-related homeobox-1; SV40T Ag, SV40 large

Ngày tải lên: 18/02/2014, 17:20

... with mal Ceramics, an insulation manufacturer in Augusta that wanted Ther-to achieve International Organization for Standardization (ISO)certification for its quality management systems Staff from ... spin off new companies And we want thosenew companies to grow and hire and support Georgia Tech againand again.” Trang 35Iowa State’s “System for Innovation”Iowa State University, a land grant institution ... spawned by a disparate cast of char-acters that included bankers, professors, real estate operators, andgovernment officials They were grappling with a dilemma North Carolina was arelative backwater

Ngày tải lên: 20/02/2014, 19:20

... Social Impact Bonds represent a potentially valuable new tool for scaling social impact. tRacy palandJian CEO, Social Finance, Inc. ForEword By TrACy PAlANdJIAN ceo, social Finance, Inc Trang ... A New Tool for Scaling Impact Q 15 Trang 1716 SoCIAl FINANCE, INC.outcomes (such as smoking cessation) are achieved Foundations could act as payor via performance-based grants on projects that ... as a panacea for every nonprofit’s funding challenges They are a tool that can work for a certain subset of nonprofits Since SIBs are best suited to scaling what works, the ideal candidates for

Ngày tải lên: 06/03/2014, 08:20

... localization of CatE and CatD, western blot analysis was performed No CatE was recovered from any sub-cellular fraction of WT100 Endosomal fractions of DCs and HaCaT contained a significantly larger ... immunoprecipitation of CatE, and (L) endosomal fraction after immunoprecipitation of CatE. Trang 10Parallel detection of CatE and CatD activityTAPA and specific catalytic activities of CatE and CatD were determined ... described here facilitates the specific and parallel measurement of CatE and CatD activity in antigen-processing organ-elles The data clearly show that our approach for detecting CatE and CatD is more

Ngày tải lên: 07/03/2014, 09:20

... Trang 1allergen Der p 2 after inhalationLinda Johansson1,2,*, Linda Svensson3,*, Ulrika Bergstro¨m4, Gunilla Jacobsson-Ekman5, Elias S J Arne´r2, Marianne van Hage1, Anders Bucht3,6and Guro Gafvelin1 ... standard chow and water ad libitum The study was approved by the Regional Animal Research Ethics Committee according to national laws Preparation of allergen House dust mite extract was prepared ... dislocation 18 h after the last aerosol challenge The trachea was cannulated with poly-ethylene tubing and BAL was performed using 1 mL aliqu-ots of Hank’s balanced salt solution to a total recovered

Ngày tải lên: 07/03/2014, 21:20

... Laura says that as a result of the CPT program, she looks at primary care and her job as a physician differently As a hospital physician at an academic center, she doesn’t have a consistent patient ... She had an existing relationship with Afisha, a Russian multimedia group that airs Russian programs on local radio station 1430AM and operates the Diaspora Newspaper in the Greater Sacramento ... staff working at Afisha for their ideas and feedback Another concern for Dr Inessa and her community partners was ensuring the accuracy of information and using culturally appropriate translations

Ngày tải lên: 14/03/2014, 09:20

... schema level. Trang 11mandatory for A1, A2 and A3 D2 is mandatory for A2, and D3 is restricted for A3 Since D1 ismandatory for A1, the form definition F1 associated with A1 holds a field for D1 However, ... the associations between activity def-initions and data object definitions As indicated above, D1 is mandatory for A1, A2 and A3, D2 ismandatory for A2, while D3 is restricted for A3 D0 and D4 are ... two models are the organizational embedding and the forms In particular,while role is a class in the meta model, actor is a class in the case handling model The cardinality repre-of forms and form

Ngày tải lên: 15/03/2014, 21:20

... will be glad to provide the latest information on any changes made to the text, plans for new editions, and reprints andtranslations already available ©World Health Organization 2002 Publications ... chemical and biological, at all stages of the food chain The potentialimpact of unsafe food on human health is of great concern, and new foodsafety systems that take a farm-to-fork perspective are ... CVDincreases with age, and improved survival rates mean that, with an ageingpopulation, a greater number of Europeans live with impaired cardiovascularhealth Around one third of CVD cases are related

Ngày tải lên: 16/03/2014, 14:20

... Project Management Team Risk Management Principles 11 Team Risk Management Functions 12 Scenario Comparing Team Risk Management to Risk Management 17 Advantages of Team Risk Management 19 Answers ... Initiate Team* Identify Analyze Plan Track Control *Note:Team is used as an action verb 12 Team Risk Management Model The Team Risk Management model is shown below Each function has a set of activities ... that both can together, but that neither could alone Accept the philosophy that the team can arrive at better solutions than any individual––even the program manager––can alone 19 Advantages and...

Ngày tải lên: 23/03/2014, 23:21

... industry Additional results are available at www.relationshipera.com, and details of the Brand Sustainability Map research methodology are available at www.relationshipera.com/brand-sustainability/bsm-info/ ... old model of marketing from the Consumer Era within a new era—an era that calls for a fundamentally different marketing mind-set In recent years, with the rapid emergence of social media and almost ... shallow approach to trust as they employ a new model of marketing Changing Within a Model versus Creating a New Model Although businesses constantly evolve, most change happens within a fundamental...

Ngày tải lên: 27/06/2014, 23:20

... removing many protectionist barriers Globalization flourished as markets opened up; new capital was made available to business with Latin America, Asia, and Central and Eastern Europe.1 A paradox of ... “qualitative” analysis that can be applied, and which would influence the rating, because, unlike a corporation, a CDO is simply a brass plate on a wall Unfortunately, CDO quantitative analysts and ... Remuneration Model Unsuitable Personal Behavior Conclusion CHAPTER Bank Capital Safeguards: Additional Capital Buffers and Reverse Convertibles Capital Issues in a Bear Market Looking for New Capital...

Ngày tải lên: 30/10/2014, 16:18