... Library of Congress Cataloging-in-Publication Data Names: Ebrahimzadeh, Amin, author | Maier, Martin, 1969- author. Title: Toward 6G : a new era of convergence / Amin Ebrahimzadeh, Martin Maier. ... human-to-avatar (H2A), avatar-to-human (A2H), andavatar-to-avatar (A2A) communications Importantly, taking into account the lim-ited speed of propagation of light, the requirements for ultra-low latency ... Alan Grier Elya B Joffe Saeid Nahavandi Jeffrey Reed Diomidis SpinellisSarah Spurgeon Ahmet Murat Tekalp Trang 4k kToward 6G: A New Era of Convergence Amin Ebrahimzadeh Martin Maier Trang 5k kCopyright
Ngày tải lên: 29/12/2021, 14:38
... law, no parts of this Trang 4An Abstract ofA New Era of Observational Capability at Ritter Observatory: Spectropolarimetry from Exoplanets to Circumstellar Disks and Beyond byJames W Davidson ... source of support Thank you, and I love you all This research has made use of the SIMBAD database, operated at CDS, bourg, France This work has been partially funded by a Small Research Grant fromthe ... Bjorkman 2006; Clarke & Bjorkman 1998) Clas-sical Be stars are also typically less polarized, ∼0.5-1%, compared to Herbig Ae/Bestars, with an average polarization around 3% (and maximum
Ngày tải lên: 19/06/2023, 09:15
Báo cáo khoa học: MicroRNA-373, a new regulator of protein phosphatase 6, functions as an oncogene in hepatocellular carcinoma pdf
... quantity of b-actin in the same sample Table 1 The oligonucleotides used in this work. TCAAATTACTTACAAGTTTTTTGAATTCTCGAGA TGATCTCTTGAACAAATTACTTACACAAAGAG Trang 10Western blotHCC cells were transfected ... acquisition and analysis software was used to quan-tify band intensities Antibodies were purchased from Tian-jin Saier Biotech and Sigma-Aldrich Statistical analysis Data are expressed as mean ... phosphatase 6 catalytic subunit; SD, standard deviation; shRNA, small hairpin RNA; siRNA, small interfering RNA. Trang 2are important for target site recognition, and they havebeen designated as
Ngày tải lên: 14/03/2014, 23:20
13C–18O bonds in carbonate minerals: A new kind of paleothermometer ppt
... MAR-J1, MZ carbonate and Sigma-carb standards made between Janu-ary, 2004 and April, 2005 Each data point represents the average of between 1 and 10 analyses of the gas from a sin-gle acid extraction ... is ca 10& higher in d18O than reactant carbonate The exact magnitude of this fractionation varies with reaction temperature and differs among the various carbonate minerals (Sharma and Clayton, ... IAEA) and three intra-laboratory calcite standards, MARJ-1, MZ carbonate and Sigma-carb Two of the standards (NBS-19 and MARJ-1) were purified from Italian Carrara marbles that were metamor-phosed
Ngày tải lên: 22/03/2014, 18:20
Đề tài " A new application of random matrices: Ext(C red(F2)) is not a group " ppt
... unital nuclear C ∗-algebra and by Voiculescu [V1], Ext(A) is a unital semi-group for all separable unital C ∗-algebras A Anderson [An] provided in 1978 the first example of a unital C ∗-algebraA ... first example of a C ∗-algebra A for which Ext(A) is not a group. 1 Introduction A random matrix X is a matrix whose entries are real or complex dom variables on a probability space (Ω, F, P ) As ... consisting of a unital C ∗-algebra B and a state τ on B. b) A family of elements (a i)i ∈I in a C ∗-probability space (B, τ) is free if for all n ∈ N and all polynomials p1, , p n ∈ C[X], one has
Ngày tải lên: 22/03/2014, 20:20
Báo cáo khoa học: Characterization and structural modeling of a new type of thermostable esterase from Thermotoga maritima ppt
... et al. 2838 FEBS Journal 274 (2007) 2832–2842 ª 2007 The Authors Journal compilation ª 2007 FEBS GTCACCTGGTAGTTACTGCCGCCGAAG-3¢,5¢-CGAC GATCTCAAT AACTTGATGATTTCAGG-3¢ and 5¢-CTC CTGAAATCATCAA GTTATTGAGATCGTCG-3¢, ... Hirooka K, Shimanuki S, Yokota Y, Hemmi H, Nakayama T & Nishino T (2004) Molecular cloning and characterization of a thermo- stable carboxylesterase from an archaeon, Sulfolobus shibatae DSM5389: ... show that EstD has esterase activity and also exhibits the typical structural features of this type of enzyme. Bacterial esterases and lipases have been classified into eight families based on a com- parison
Ngày tải lên: 23/03/2014, 09:20
Đề tài " A new construction of the moonshine vertex operator algebra over the real number field " pot
... Annals of Mathematics A new construction of the moonshine vertex operator algebra over the real number field By Masahiko Miyamoto Annals of Mathematics, 159 (2004), 535–596 A new ... [DMZ] that V is a framed VOA of rank 24. Our main purpose in this paper is to reconstruct V as a framed VOA. Another important example of framed VOAs is a code VOA M D for an even linear code ... to a framed VOA structure on V . In this paper, we will show several techniques to transform framed VOAs into other framed VOAs. An advantage of our ways is that we can construct many framed
Ngày tải lên: 28/03/2014, 22:20
Báo cáo khoa học: Methanoferrodoxin represents a new class of superoxide reductase containing an iron–sulfur cluster docx
... 5¢-ATGGTAGGTCTCAAATGATAGGAA ATGAAGAAAAAATAAATAAGC-3¢; and mm0632rev, 5¢-ATGGTAGGTCTCAGCGCTGGCTTTCCAGACGCA TTTTTTGC-3¢. The gene mm0632 was cloned via BsaI restriction sites in plasmid pASK-IBA3 (IBA GmbH, Go ¨ ttingen, ... [7]. Methanosarcina mazei is one of the methanogenic archaeons, which are characterized by the ability to generate methane as the major end product of energy metabolism [8]. Many Methanosarcina strains ... structure of a monofunctional catalase from Methanosarcina barkeri. Arch Microbiol 171, 317–323. 39 Brioukhanov A, Netrusov A, Sordel M, Thauer RK & Shima S (2000) Protection of Methanosarcina barkeri against
Ngày tải lên: 28/03/2014, 23:20
WORLD INVESTMENT REPORT 2012 Towards a New GeNeraTioN of iNvesTmeNT Policies potx
... and Ganu Subramanian. Production and dissemination of WIR12 was supported by Elisabeth Anodeau-Mareschal, Severine Excofer, Rosalina Goyena, Natalia Meramo-Bachayani and Katia Vieu. The manuscript ... from the advice of Lorraine Eden, Arvind Mayaram, Ted Moran, Rajneesh Narula, Karl Sauvant and Pierre Sauvé. Bradley Boicourt and Lizanne Martinez provided research and statistical assistance. ... a New Generation of Investment Policies ABBREVIATIONS ADR alternative dispute resolution ASEAN Association of Southeast Asian Nations BIT bilateral investment treaty BRIC Brazil,
Ngày tải lên: 30/03/2014, 12:20
Buying Trances: A New Psychology of Sales and Marketing
... tecting Against Advertisers, Marketers and Big Business paganda, says we are exposed to more than 3,000 Pro-commercial messages a day Some of my other research revealed the following: The average ... 2,500 advertising messages per day, andthat children see over 50,000 TV commercials a year In our view, as many as one-quarter of all these ads are deliberately tive Increasingly, the family of ... is a 10-year rule stating that virtually anyone can be-come a genius—or at least a superior performer—in a niche if they apply themselves in that area for a decade As I think about how I became
Ngày tải lên: 07/04/2014, 11:17
scientific american - 1995 08 - a new theory of aids latency
... through a vessel containing an amalgam of sodi- um separated by a glass partition from mercury. After a while the amalgam was found to have lost a certain amount of its weight, while the same amount ... “Australasian Impact.” Unlike the dinosaur-killing comet that hit the earth 65 million years ago (spawning global disaster and much belated media coverage), the Austral- asian collision remains ... provides an ideal chronicle Neumann of the University of North of climate and sea-level changes... physiological abnormalities causing apnea Largely as a result of this paper, the apnea hypothesis
Ngày tải lên: 12/05/2014, 15:01
a new deal of welfare empowering people to work
... deterred from participating in activities such as voluntary work Their fear of participating was twofold: they were afraid that any payment of expenses would be taken into account as earnings and cost ... this year SCIE emphasises the importance of the cooperative role of a range of agencies in supporting particular groups of people Not everyone leads organised lives and some people are at a particular ... work if that is a suitable and realistic route SCIE has recently launched a review of research and existing practice of health and social care services in supporting parents with mental health problems
Ngày tải lên: 26/05/2014, 23:26
context-aware pervasive systems architectures for a new breed of applications
... Andiwijaya Sumartono, and SuHui Chuah on the CALMA agent-based Web service framework; and AmirPadovitz and Arkady Zaslavsky on context-aware messaging and contextmodeling Suan Khai Chong and Shonali ... pervasive computing is a study of pervasive computer systems (a combination of hardware and software)13 that are aware of context and can automatically adapt and respond to such context Context awareness ... primacy of the situation abstraction and has noted that an agent(e.g., a human) is able to individuate a situation According to Devlin(1991), a situation is a “structured part of reality that
Ngày tải lên: 01/06/2014, 00:18
Tài liệu UN Global Compact-Accenture CEO Study A New Era of Sustainability in Consumer Goods pdf
... Making progress: From strategy to execution 18 Part Four Pioneers of the new era 24 Part Five Accelerating the journey to the new era of sustainability 28 Toward a new era of sustainability: ... and in collaboration with others Many challenges and discontinuities lie ahead 34 A new era of sustainability is far from guaranteed and will require both leadership and urgency As Paul Polman, ... recovered and turned into a new revenue stream Enhanced brand reputation has also been an outcome of the program: in 2009, Nokia won the 'Green Company of the Year' award in India, a marketplace critical...
Ngày tải lên: 18/02/2014, 21:20
Life and Physical Sciences Research for a New Era of Space Exploration docx
... Administrative Coordinator TANJA PILZAK, Manager, Program Operations CELESTE A NAYLOR, Information Management Associate CHRISTINA O SHIPMAN, Financial Officer SANDRA WILSON, Financial Assistant ... Program Operations CELESTE A NAYLOR, Information Management Associate CHRISTINA O SHIPMAN, Financial Officer SANDRA WILSON, Financial Assistant viii AERONAUTICS AND SPACE ENGINEERING BOARD RAYMOND ... database) Coupling the database with a genetic bank and repository of astronaut samples would ensure the availability of the maximal amount of data to address future investigations Because of...
Ngày tải lên: 05/03/2014, 11:21
NEW KNOWLEDGE IN A NEW ERA OF GLOBALIZATION pptx
... Chapter 13 Building Sustainable Capacity for Disease Diagnosis in Sub-Saharan Africa: Case Studies of Cooperation in Diagnostic Pathology 243 Renato Mariani-Costantini, Khalid Dafaallah Awadelkarim, ... Indonesia’s Surabaya City and Jakarta City, and Malaysia’s Seberang Perai and Kuala Lumpur While Taiwan is opening up to the world, the world is also learning about the culture of Taiwan Currently, ... Indian Technical Education System 73 Mahadevi S Banad and Mahadev Talawar Chapter How to Discover a New World Without Being in Danger of Wreck 97 Miguel González-Carbajal Pascual and Ludmila Martínez...
Ngày tải lên: 27/06/2014, 07:20
A Portrait of the Visual Arts - Meeting the Challenges of a New Era pot
... market At the same time, visual artists’ career patterns have also been changing, as academic training has taken on greater importance as a credential for emerging artists and as artists’ career ... patrons and early capitalist tycoons What is new is the rapid proliferation and specialization of actors on the art world stage The escalation of market prices has given rise to a cast of characters ... to paintings, sculpture, and photographs, as well as certain categories of media art and performance art3 Our Approach A central analytical challenge was to identify a set of dimensions around...
Ngày tải lên: 23/03/2014, 03:20
Tài liệu A New Era for Conservation docx
... resources) adapt to climate change 29 A New Era for Conservation: Review of Climate Change Adaptation Literature March 12, 2009 B Grasslands and Shrublands Climate Change Impacts and Vulnerability Assessment ... outpace the capacity of many organisms to adapt in this classical sense U.S natural resource managers and conservationists are accelerating their plans and actions for climate change adaptation, ... Upgrade, and Increase Monitoring, Data Analysis and Management; • Plan for and Adapt to Sea Level Rise; and • Identify and Fund Focused Climate Change Impacts and Adaptation Research and Analysis...
Ngày tải lên: 25/01/2014, 20:20
Tài liệu Physics in a New Era An Overview doc
... the Academy has a mandate that requires it to advise the federal government on scientific and technical matters Dr Bruce Alberts is president of the National Academy of Sciences The National Academy ... JILA/University of Colorado, John C Mather, NASA Goddard Space Flight Center, Albert Narath, Lockheed Martin Corporation (retired), Venkatesh Narayanamurti, Harvard University, V Adrian Parsegian, ... Laboratory; Omega laser experiment image courtesy of David Arnett, University of Arizona Tools of the Trade Images courtesy of Fermi National Accelerator Laboratory Societal Benefits from Accelerator Science...
Ngày tải lên: 12/02/2014, 16:20
Tài liệu Toward a New Literacy of Cooperation in Business MANAGING DILEMMAS IN THE 21ST CENTURY pdf
... group an action or reaction among actors that is triggered by an CATALYSIS outside agent a very small amount of catalytic agent can facilitate a very large-scale reaction If we think of tools and ... go hand-in-hand, posing a choice at every juncture, a choice that arises because of a basic dilemma—traditionally framed as a social dilemma Social Dilemmas: The Problem of the One and the Many ... Kollock, author of Social Dilemmas: The Anatomy of Cooperation, explains that, Social dilemmas are situations in which individual rationality leads to collective irrationality That is, individual rational...
Ngày tải lên: 18/02/2014, 00:20