... parabutoporin, this could explain the higher antibacterial activity on Gram-negative bacteria for parabutoporin compared to opistoporin Also with magainin analogs, an increase in antibacterial activity ... Gram-negative bacteria, while melittin and mastoparan are more active against Gram-positive bacteria As it has been described that the NH2-terminal a-helical domain of dermaseptin S (amino acids 1–18) ... for antimicrobial activity and is even more antibacterial than dermaseptin (34 amino acids) [19], peptides consisting of amino acids 7–22 of parabutoporin (an a-helical part having the four amino...
Ngày tải lên: 21/02/2014, 15:20
... Pulping and International Name the Pulp Mill Location Manufacturing Arm AR Yes- Pulp and Yes Industry Domtar 11.5% Manufacturing Corporation Internationa I 13.5% AL Yes- Pulp and Yes Manufacturing ... researching the use of bamboo in the paper industry Many companies in Asia have made advances in using bamboo in products such as textiles, flooring, cosmetics, paper, and food However, many of these ... appropriate In the academic field of business a feasibility analysis is developed to help a client make a game-changing decision My feasibility analysis follows the general criteria of an analysis...
Ngày tải lên: 18/03/2014, 02:20
CCC Proposal for a new Writing Requirement in the Core 9.16.20
... have expressed concerns about the elimination of EYE, and have indicated that they may wish to pursue a different approach for students in their program, in particular possibly retaining an anti-racism ... your thinking and writing through processes such as reading, drafting, reviewing, collaborating, revising, editing, designing, and redesigning Writing and ideas remain relatively unchanged in response ... These assessments are often facilitated by a team of crossdisciplinary faculty and academic assessment staff and involve the evaluation of student writing samples using a rubric that measures...
Ngày tải lên: 02/11/2022, 13:35
the american banker as international investor have the new banking powers in the united states increased the volatility of lending into emerging economies
... ABSTRACT Title of Document: THE AMERICAN BANKER AS INTERNATIONAL INVESTOR: HAVE THE NEW BANKING POWERS IN THE U.S. INCREASED THE VOLATILITY OF LENDING INTO EMERGING ECONOMIES? ... “Deregulation of U.S. banks, via consolidation and a volatile earnings stream, increased volatility in bank lending to emerging economies, and, in due course, worsened the financial crises in emerging ... emerging economies.” The volatility of U.S. bank lending to emerging economies has increased during the past twenty years. To explain the across-the-board, increasing volatility of U.S. bank emerging...
Ngày tải lên: 03/06/2014, 02:14
Báo cáo hóa học: " A New Method for Estimating the Number of Harmonic Components in Noise with Application in High Resolution Radar" pdf
... devoted to a high-resolution radar application The goal is to find the most accurate estimate of the range profile of a radar target using its complex signature in the frequency domain An Estimation ... variation is not necessarily linear, but the results obtained in this case can be generalized This type of variation has also the advantage of being the simplest model which is able to integrate ... function variation for S/N = 10 dB Just like in the case of the first-order AR random process, the detection rate obtained using the new approach begins to decrease when the two poles start approaching...
Ngày tải lên: 23/06/2014, 01:20
Báo cáo toán hoc:"A New Lower Bound on the Density of Vertex Identifying Codes for the Infinit" doc
... simplify the analysis, we state and prove five structural lemmas and three claims about the discharging process. The difference between our claims and our structural lemmas is that the claims are statements ... stating six discharging rules, and verifying that af t er the discharging phase, each vertex has charge at least 12/29. Showing that each vertex finishes with sufficient charge is a lengthy task. ... the sets that contain 2 and 4, and we add the sets {1, 2}, {3}, and {4, 5} As above, we assume that 10 is uncovered (since the other case is easier) Since 10 is uncovered, P contains the...
Ngày tải lên: 08/08/2014, 01:20
Radioactivity in the environment chapter 4 a cross cultural approach to radiation ethicsa
... ubiquitous In the Bhagavadgita, Krishna states, “I am the same to all beings…In a Brahma…and an outcast, the wise see the same thing” (The Bhagavadgita, 1973, 9:29 and 32) Similar statements are reported ... in other parts of the world There is at least anecdotal evidence that in Latin America, in Muslim Countries, in Africa, in China, and in South East Asia, decision making is not primarily a matter ... than 30% of the world’s population is living in Europe and the Americas, but over 50% in Asia and another 20% in Africa and the Middle East Can we really expect the majority of mankind to adopt...
Ngày tải lên: 03/01/2018, 17:48
HashClone: A new tool to quantify the minimal residual disease in B-cell lymphoma from deep sequencing data
... TACATGGACGTCT CGAGAGATTACACAGCCCCGGGTATAGCAGAA CGAGAGATTACACAGCCCCGGGTATAGCAGAA CCAGGCCCCT CCAGGCCCCT TGCGAGAGGCGCGAATAACTGGAACCCCATTG TGCGAGAGGCGCGAATAACTGGAACCCCATTG ACTA ACTA GCGACCCAGCGAAATTACGATATTTTGACCGG ... GCGACCCAGCGAAATTACGATATTTTGACCGG GCGACCCAGCGAAATTACGATATTTTGACCGG GTTTGACTACT GTTTGACTACT GCGAGAGATCCAGGGTATAGCAGTGGCTGGAA GCGAGANNNNCANNNTATANCANNNGCTGGAA CCTGGGATACTACTACTACGG CNNNGGATACTACTACTACGG TGTGCGAGAAGCAATTTTGGAGTGGTCTAAAT ... GCGAGAGATCCAGGGTATAGCAGTGGCTGGAA 100% (63/63 nt) CCTGGGATACTACTACTACGGTATGGACGTC CCTGGGATACTACTACTACGGTATGGACGTC TGTGCGAGAAGCAATTTTGGAGTGGTCTAAAT TGTGTGCGAATCAATTTTGGAGTGGTCTAAAT TACATGGACGTCT TACATGGACGTCT...
Ngày tải lên: 25/11/2020, 16:28
The Mediational Role of Classroom Practices During the Silent Period: A New-Immigrant Student Learning the English Language in a | Mainstream Classroom |
... establishing and maintaining the joint-attentional frame between Juan, the teacher, and the testing materials throughout the testing practice Within this triadic joint-attentional frame, Juan paid ... CONTEXTUAL AFFORDANCES FOR LANGUAGE LEARNING Recent advances in SLA research have underscored the role of interactional and contextual affordances for language learning Ellis and Larsen-Freeman (2006), ... The Mediational Role of Classroom Practices During the Silent Period: A New-Immigrant Student Learning the English Language in a Mainstream Classroom ANA CHRISTINA DaSILVA IDDINGS University...
Ngày tải lên: 22/10/2022, 19:14
Development of a new method to determine the axial void velocity profile in BWRs from measurements of the in-core neutron noise
... velocity increases monotonically in the channel from the inlet, first in a quadratic manner, then the increase slows down, either leading to an inflection point, or to a linear increase towards the ... reduced as compared to the polynomial fitting If the onset point of boiling was known, then clearly the polynomial RAMONA5 user manual (RAMONA, 2001) The slip parameter 𝑆 is calculated using the ... does not exist in an analytical form, and partly that it assumes that the boiling starts at the inlet, i.e at 𝑧 = 0, which is not true in practical cases The first of these disadvantages does not...
Ngày tải lên: 24/12/2022, 22:34
new product development in the fashion industry a case study in vietnam
... prototyping, and marketing By incorporating innovative ideas and addressing product deficiencies, firms can enhance their market share and stay competitive in a rapidly evolving marketplace.In the last ... decades, the market has changed rapidly and continuously, increasing the importance of investing in the development and innovation of all companies (M Rossi et al [9]) The product innovation and ... method via applications in the case study Chapter 5 evaluates the completion level of the report, and it also assesses the advantages and remaining disadvantages Some recommendations for plans to...
Ngày tải lên: 22/05/2024, 11:07
Luận văn thạc sĩ Kỹ thuật công nghiệp: New product development in the fashion industry: A case study in Vietnam
... overcome the weaknesses of the company’s current products In the last decades, the market has changed rapidly and continuously, increasing the importance of investing in the development and innovation ... outstanding value associated with the sustainable development strategy, towards the leading position in the global textile and apparel market in the coming time The company mission is that they ... orientation based on proposal method Applied The main reason for not applying all the suggested plan is that Thanh Cong wants to utilize their manufacturing background by making fabric and manufacturing...
Ngày tải lên: 30/07/2024, 16:50
Báo cáo y học: " WT1 PEPTIDE VACCINATION IN COMBINATION WITH IMATINIB THERAPY FOR A PATIENT WITH CML IN THE CHRONIC PHASE"
... 406a. 27. Oka Y, Tsuboi A, Murakami M, Hirai M, Tominaga N, Nakajima H, Elisseeva OA, Masuda T, Nakano A, Kawakami M, Oji Y, Ikegame K, Hosen N, Udaka K, Yasukawa M, Ogawa H, Kawase I, Sugiyama ... Takenouchi3, Anri Sai-toh1, Norihiro Watanabe1, Tatsuo Furukawa2, Ken Toba3, Ichiro Fuse4, Yoshifusa Aizawa3, Manabu Kawa-kami5, Yoshihiro Oka6, Haruo Sugiyama6 and Masuhiro Takahashi1 1. Laboratory ... T, Osaki T, Kyo T, Nakajima H, Elisseeva OA, Oji Y, Kawakami M, Ikegame K, Hosen N, Yoshihara S, Wu F, Fujiki F, Murakami M, Masuda T, Nishida S, Shirakata T, Nakatsuka S, Sasaki A, Udaka K,...
Ngày tải lên: 26/10/2012, 09:39
A study of words in the language of sports in english and vietnamese
... people are aware of the existence of collocation. Instead, they give more importance to grammar and the grammar- translation approach has played a key role in the teaching of English in Vietnam for ... combine in a language to produce natural-sounding speech and writing. Collocations run through the whole of the English language, as in any other languages. Choosing the right collocation will make ... words in the language of sports is not an easy task for students in Vietnam. Certainly, there are also translations of terms characteristic of a given sports in different languages of the world and...
Ngày tải lên: 26/11/2013, 13:19
Tài liệu Building a Windows IT Infrastructure in the Cloud pdf
... created It also has the advantage of being owned and operated by a company that knows a thing or two about always-on availability! Those reasons alone make it a great place for a new IT infrastructure ... lines the following: Create a new database named asterisk This is where the main Asterisk/FreePBX settings will be housed Create a new database named asteriskcdrdb The details of each phone call ... /var/lib/asterisk/bin/module_admin enable fw_ari Installs all the FreePBX modules that ship with the source code but aren't automatically enabled or installed /var/lib/asterisk/bin/module_admin installall Upgrades all the...
Ngày tải lên: 17/02/2014, 08:20
Tài liệu Báo cáo khoa học: Evidence that the assembly of the yeast cytochrome bc1 complex involves the formation of a large core structure in the inner mitochondrial membrane pdf
... the assistance of specific chaperone proteins is also required The available data indicate that the accessory factor Bcs1p is involved in the binding of ISP to an immature bc1 intermediate Yeast ... PAGE analysis of the mitochondrial membranes isolated from all these deletion strains and from a wild-type strain In the DQCR9, DISP and DBCS1 strains, a protein band of approximately 500 kDa ... temperature; each gel strip was then placed horizontally in the gel-pouring apparatus for the second dimension (SDS ⁄ PAGE) [48], already containing the separating gel (15% polyacrylamide and 0.1%...
Ngày tải lên: 18/02/2014, 08:20
báo cáo hóa học:" Development and evaluation of a clinical algorithm to monitor patients on antiretrovirals in resource-limited settings using adherence, clinical and CD4 cell count criteria" ppt
... Thomas, Keith McAdam and all the staff of the Adult Infectious Disease Clinic and the Academic Alliance The study was funded by the Division of Intramural Research of the National Institute of Allergy ... http://www.jiasociety.org/content/12/1/3 Table 1: Univariate analysis of variables associated with viral failure in 496 Ugandans on ART at the Infectious Diseases Institute, Kampala, Uganda Variable Total ... Mayanja H, Moore RD, Bates M, Quinn TC: Response to antiretroviral therapy in HIV-infected patients attending a public, urban clinic in Kampala, Uganda Clin Infect Dis 2006, 42:252-59 Kitahata...
Ngày tải lên: 20/06/2014, 08:20
Báo cáo hóa học: "Bearing Fault Detection Using Artificial Neural Networks and Genetic Algorithm" pdf
... ANNs and the data of the second set of run were used for testing In both cases, the testing data sets had no part in the training of ANNs In each case, the training was based on the training data ... normal bearings and the other with an induced fault on the outer race of the RHS bearing The outer race fault was created as a small line using electro-discharge machining (EDM) to simulate the initiation ... normalization with zero mean and a standard deviation of for each feature set was attempted Another normalization scheme was also examined by making the features zero mean and then normalizing...
Ngày tải lên: 23/06/2014, 01:20
Design optimization of permanent magnet synchronous motors using response surface analysis and genetic algorithm
... Generally an analytical expression of the flux distribution in the machine is unattainable Another approach usually used in electric machine analysis is the circuital representation Using appropriate ... applied along the q-axis and Lq becomes current dependant Classical analytical tools are unable to take saturation into account in modelling these variations of Lq as non-linearities are involved In ... Finally, the development of rare earth permanent magnets in the 60’s gave a significant advantage to permanent magnet excitation The early rare earth magnets were alloy of Samarium and Cobalt (SamCo)...
Ngày tải lên: 04/10/2015, 15:45