a new basis for order

... Integrated management • Making risk management an integral and vital part of project management • Adapting risk management methods and tools to a project’s infrastructure and culture Trang 12SEI ... risk management concepts since Janu-ary 1990 as an efficient means to improve the success of programs developing soft-ware-intensive systems Team Risk Management is a new paradigm for managing ... 8].Kloman summarized the meaning of risk management in the context of a number of different disciplines in an article for Risk Analysis: What is risk management? To many social analysts, politicians,

Ngày tải lên: 23/03/2014, 23:21

... (Ed.), Natural language processing New York: Algorithmics Woods, W A (1980) Cascaded ATN grammars American Journal of Computational Linguistics 1, 1-12 Woods, W A (1984) Natural language communication ... of natural language and vision, Seattle, WA O Nuallain, S., & Smith, A (1994) An investigation into the common semantics of language and vision Paper presented at the AAAI spring symposium, March ... Strategies in NLP Hillsdale, NJ: Erlbaum 271 The Search for Mind Smith, A., B Farley and Ó Nualláin, S (1996) Visualization of natural language In Gretal (Ed.) Natural Language Processing and

Ngày tải lên: 03/04/2014, 12:07

... regression method, we create a new set of data with equally spaced nodes in a given web defined in the range of parameters of original unequally spaced nodes Each value of new equally spaced nodes is noise ... Trang 11 Summary 2 Introduction about function regression 3 RBF Neurals Networks and a new algorithm for training RBF networks 4 Experiment 5 Conclusion Trang 21 SUMMARY Gaussian radial basis ... HDH-1phase algorithm with the input data is new equally spaced nodes (circles) and the reduction value of each node Trang 52.3 The approximately multivariable function problemApproximating multivariable

Ngày tải lên: 12/04/2014, 15:40

... Leaf Rust* DAGMAR S. RovERATn*'% ANA REGINA R. TEIXEIRA and WALKYRIA B. C. MORAES Authors' address: Se^ao de Bioquimica Fitopatologica, Instituto Biologico, CP. 7119, 0105! Sao Paulo, ... 5 semanas. A prote9ao observada foi sistemica. O indice de prote^ao foi determinado peia redugao do numerc medio de lesoes por folha. Uma redu^ao no tamanho das lesoes nas folhas tratadas, bem ... a pure suspension of the bacterium was shown to induce local protection against a later inoculation with a cultivar-pathogenic race of H. vasta- 156 DAGMAR S. ROVERATD, ANA REGINA R, TEIXEIRA

Ngày tải lên: 05/05/2014, 08:45

... develop and validate a scale that could be administered to anticoagulation patients generally; that is, across indication for anticoagulation and across mod-els of anticoagulation management ... ingela.wiklund@astrazeneca.com; Ewa Hedner - ewa.hedner@astrazeneca.com; Gail Wygant - gail.wygant@astrazeneca.com; Ole Hauch - ole.hauch@astrazeneca.com; Cheryl Beadle Marple - cheryl.marple@astrazeneca.com; ... patients with mechanical heart valves, valvular heart dis-ease, myocardial infarction, and atrial fibrillation [1] It is often intended that anticoagulation be maintained over the long term; for

Ngày tải lên: 20/06/2014, 15:20

... that can be used by HCCA: t AP STA A Poll TA DA NO Poll t + tPOLL + tNO DELAY + 2tPROP DELAY t AP STA A (i) Polling a Station That Has No Packets for Transmission (Figure 1(a)) The AP polls a ... traffic load is represented in Figure 10 It can be seen that regarding MP traffic, performance degradation starts at significantly lower load in POAP than in AWPP HCCA exhibits a steady behavior to a limited ... destination station broadcasts a STATUS packet acting STA B tus Sta k) (ac t + tPOLL + tSTATUS Da (4) 2.3 The POAP Protocol POAP is a high-performance polling-based protocol that exploits the feedback

Ngày tải lên: 21/06/2014, 05:20

... Trang 1Volume 2010, Article ID 976913, 10 pagesdoi:10.1155/2010/976913 Research Article A New Method for Least-Squares and Minimax Group-Delay Error Design of Allpass Variable Fractional-Delay ... For the past decade, the design of variable fractional-delay (VFD) digital filters became an important topic in digital signal processing due to their wide applications in signal processing and ... usually stable when mean delay of the desired response is equal to the order of the designed allpass filter and the range of adjustable parameter is properly assigned This paper is organized as

Ngày tải lên: 21/06/2014, 07:20

... recent years, this generalized variational inequalities become an attractive field for many researchers and have many important applications in electricity markets, transportations, economics, and ... techniques have been used to develop proximal iterative algorithm for variational inequalitiessee 17– 22 In addition Nesterov 23 introduced a dual extrapolation method for solving variational inequalities ... Trang 1Volume 2010, Article ID 657192, 20 pagesdoi:10.1155/2010/657192 Research Article A New Method for Solving Monotone Generalized Variational Inequalities Pham Ngoc Anh and Jong Kyu

Ngày tải lên: 21/06/2014, 07:20

... Yokohama, Yokohama, Japan, 2000 16 W Takahashi and Y Ueda, “On Reich’s strong convergence theorems for resolvents of accretive operators,” Journal of Mathematical Analysis and Applications, vol ... C3∗ , and C4 on the results in 10, 20 are dropped A single mapping of the results in is replaced by a finite family of mappings Preliminaries and Lemmas A Banach space E is said to have Gateaux ... of a finite family of accretive operators,” Nonlinear Analysis: Theory, Methods & Applications, vol 70, no 6, pp 2344–2351, 2009 S Kamimura and W Takahashi, “Approximating solutions of maximal

Ngày tải lên: 21/06/2014, 20:20

... limitations has led to a situation where damage is continuing and has placed many important items at risk This has created an urgent need for a technique that can capture the information in each ... 125–135, 1997 E Prados, F Camilli, and O Faugeras, “A unifying and rigorous shape from shading method adapted to realistic data and applications,” Journal of Mathematical Imaging and Vision, vol ... conservation can continue and no changes are made that are irreversible If the results from a digital approach are not acceptable, the more challenging and expensive physical approach can still be applied

Ngày tải lên: 21/06/2014, 20:20

... subspace approach to multiple emitter location and spectral estimation, Ph.D thesis, Stanford University, Stanford, Calif, USA, 1981 [3] A Paulraj, R Roy, and T Kailath, “A subspace rotation approach ... is based on the original idea which consists in reformulating the estimation problem as a classification problem with two classes An analytical demonstration is provided for a special case of a ... [13] A Quinquis, E Radoi, and S Demeter, “Enhancing the resolution of slant range radar range profiles using a class of subspace eigenanalysis based techniques: A comparative study,” Digital Signal

Ngày tải lên: 23/06/2014, 01:20

... Trang 5Changing Within a Model versus Creating a New ModelAlthough businesses constantly evolve, most change happens within a fundamental paradigm for an industry Truly transformative change, though, ... a year after iTunes’ launch in April of 2003, Apple owned 92.1 percent market share for hard-disk digital music players and 70 percent market share of all MP3 downloads The company had a value ... population has flown on an airplane,3 and Southwest Airlines stands out as the industry’s clear leader in customer satisfaction and profitability.Apple and Southwest Airlines achieved breakthrough

Ngày tải lên: 27/06/2014, 23:20

... Belarus Belgium Bosnia and Herzegovina Bulgaria Croatia Czech Republic Denmark Estonia Finland France Georgia Germany Greece Hungary Iceland Ireland Israel Italy Kazakhstan Kyrgyzstan Latvia Lithuania ... Greece Malta Italy Spain Portugal Israel France Switzerland Netherlands Germany United Kingdom Austria Belgium Sweden Denmark Norway Finland Yugoslavia Bulgaria Hungary Romania Slovakia Czech ... information and data so that they can make informed decisions to prevent harm Nationally collected data can be compared with international norms and standards to ensure that public health is at...

Ngày tải lên: 16/03/2014, 14:20

... Slovakia a TFYR Macedonia Hungary Croatia Bulgaria Kazakhstan Georgia Turkmenistan Albania Romania Azerbaijan Belarus Armenia Republic of Moldova Kyrgyzstan Uzbekistan 50 100 150 200 250 300 Availability ... Estonia Norway United Kingdom Poland Italy Romania Czech Republic Malta Denmark Latvia Portugal Ukraine Slovenia Bulgaria Russian Federation Slovakia Kyrgyzstan Spain Kazakhstan Turkmenistan Hungary ... tropical-plant fat and oil, are also strong stimulators for raising LDL levels, as are some transfatty acids (49) A major saturated fat, stearic acid, present in beef fat and lard, a 300 Men 200 100 Deaths...

Ngày tải lên: 28/03/2014, 23:20

... well as according to animal care standards deemed acceptable by the Association for the Assessment and Accreditation of Laboratory Animal Care International (AAALAC) All experiments were performed ... 5’ GGCACTATTGGAGCTAAGAC 3’ (reverse primer), SIV-P 6FAM-AGATTTGGATTAGCAGAAAGCCTGTTGGA-TAMRA (TaqMan probe) The signal was finally compared to a standard curve of known concentrations from 107 ... subcutaneously with PMPA, 20 mg/kg/day, and FTC, 50 mg/kg/day Quantitative assay for SIVmac251 viral RNA levels For measurement of plasma SIVmac251 RNA levels, a quantitative TaqMan RNA reverse transcription-PCR...

Ngày tải lên: 12/08/2014, 23:23

... hyperuricemia [21-24] Contemporary use of alkalinization, hydration and rasburicase at 0.10 mg/kg for 3-5 days maintains the same efficacy [25] Anyway, we may have favourable issues by changing the ... prevent and treat hyperuricemia include allopurinol and alkalinization, associated with an aggressive hydration Rasburicase presents various features that give it a more favourable profile than standard ... because each metabolic derangement is associated with remarkable clinical manifestations Hyperuricemia and hyperphosphatemia severely worsen renal functionality; hyperkalemia and hypocalcemia...

Ngày tải lên: 31/10/2012, 14:59

... lives AFFIRMATIONS Jeff Staniforth, the creator of Sculptor 3, an amazing software that can make affirmations work for anyone, has this to say about affirmations: “By definition, an affirmation ... poem like a mantra as often as I can remember: Thank you for the abundance, Thank you for the wealth; Thank you for all the happiness, Protections and Good Health Repeat this mantra consistently ... a certain prejudice towards certain people or race, try to make an extra effort to love them unconditionally For example, if you are biased against Muslims in general, make an extra effort to...

Ngày tải lên: 15/12/2013, 06:15

... component on a PC is that there are a wide variety of devices available for the PC platform, as opposed to the UNIX platform This also has an important practical advantage in that a much Fig 14.2 ... this as an input to a separate "playback" application The "playback" is not strictly a playback in the sense that users are still allowed to move about and interact in the virtual world An example ... used for VR applications Currently, all major UNIX workstation vendors have specific platforms targeted to the VR market These workstations usually have a enhanced graphics performance and specific...

Ngày tải lên: 23/01/2014, 07:20

... Upgrade, and Increase Monitoring, Data Analysis and Management; • Plan for and Adapt to Sea Level Rise; and • Identify and Fund Focused Climate Change Impacts and Adaptation Research and Analysis ... changes associated with climate change are already having a significant biological impact across a broad range of natural systems For example, across North America, plants are leafing out and ... the capacity of many organisms to adapt in this classical sense U.S natural resource managers and conservationists are accelerating their plans and actions for climate change adaptation, in large...

Ngày tải lên: 25/01/2014, 20:20

... (Mech) 82nd ABN 82nd Airborne Division AAC Acquisition Advice Code ABF Availability Balance File AMC Army Materiel Command ASB Aviation Support Battalion ASL Authorized Stockage List AVIM Aviation ... repair times, and reduced equipment availability In many cases, maintainers who were unable to wait any longer for parts to maintain readiness had to make extra efforts to work around part availability ... Decisions, Santa Monica, CA: RAND Corporation, MR-1150 -A, 2002; Marygail K Brauner et al., Dollars and Sense: A Process Improvement Approach to Logistics Financial Management, Santa Monica, CA: RAND...

Ngày tải lên: 17/02/2014, 17:20