... leukemia patients with residual disease on imatinib mesylate Clin Cancer Res 2010, 16:338-47 Moriai R, Asanuma K, Kobayashi D, Yajima T, Yagihashi A, Yamada M, Watanabe N: Quantitative analysis ... trials are indicated with a blue star, the vaccine therapy trials with a red circle, and the combined cellular and vaccine therapy trials with a white triangle Cellular Therapy Trials The adoptive ... declare that they have no competing interests Abbreviations (A) : astrocytoma; (AA): anaplastic astrocytoma; (alloCTL): alloreactive cytotoxic T lymphocytes; (AODG): anaplastic oligodendroglioma;...
Ngày tải lên: 18/06/2014, 16:20
... between data driven approaches (e.g use of statistical criteria using for example factor analysis), patient approach (e.g estimation of frequency or importance of the items), and an expert approach ... validations assessed validity (n = 18, 69.2%) and always followed a correlational approach Validation instruments varied across the different disease groups For example, self-efficacy scales for ... http://www.hqlo.com/content/7/1/86 cacy instruments for patients with the chronic diseases diabetes, COPD, asthma, arthritis, and heart failure We synthesized the data in a narrative way and used absolute numbers and proportions...
Ngày tải lên: 18/06/2014, 19:20
Báo cáo khoa học: A new approach for distinguishing cathepsin E and D activity in antigen-processing organelles pdf
... Tsukuba T, Yamamoto S, Yanagawa M, Okamoto K, Okamoto Y, Nakayama KI, Kadowaki T & Yamamoto K (2006) Cathepsin E-deficient mice show increased susceptibility to bacterial infection associated with ... cathepsin D activity J Pept Sci 11, 166–174 31 Yasuda Y, Kageyama T, Akamine A, Shibata M, Kominami E, Uchiyama Y & Yamamoto K (1999) Characterization of new fluorogenic substrates for the rapid and sensitive ... Okamoto K, Okamoto Y, Yanagawa M, Kohmura K, Yasuda Y, Uchi H, Nakahara T, Furue M, Nakayama K, et al (2003) Association of cathepsin E deficiency with development of atopic dermatitis J Biochem...
Ngày tải lên: 07/03/2014, 09:20
Báo cáo khoa học: The competitor-introduced Gc recruitment system, a new approach for screening affinity-enhanced proteins doc
... and pLMZ-K3 5A- H using 50-nucleotide primers containing a region homologous to that directly upstream of PHOP2 (5¢-ATACAATTAATTGACATCAGCAGACAGCAAAT GCACTTGATATACGCAGCTCGACTACGTCGTAAG GCCG-3¢ and ... cells, and the coding region of the binding candidates was amplified by PCR using primers 5¢-AAATATAAAACGCTAGCGTCGACATGGC GC-3¢ and 5¢-AGCGTAAAGGATGGGGAAAG-3¢ The final ratio of target cells was determined ... The fragments encoding Z variants were amplified from pUMZ-WT and pUMZ-K3 5A [7] using primers 5¢-TTTTGTCGACATGGCGCAACACGA TGAAGCCGTAGACAAC-3¢ and 5¢-AAAAGGATCCTT ATTTCGGCGCCTGAGCAT-3¢, and inserted...
Ngày tải lên: 22/03/2014, 21:20
Báo cáo hóa học: " A New Approach for Estimation of Instantaneous Mean Frequency of a Time-Varying Signal" doc
... of adaptive TFDs is based on signal decomposition In practice, no TFD may satisfy all the requirements needed for instantaneous feature extraction and identification for nonstationary signal analysis ... Krishnan, R M Rangayyan, G D Bell, and C B Frank, “Adaptive time-frequency analysis of knee joint vibroarthrographic signals for noninvasive screening of articular cartilage pathology,” IEEE Trans ... (MPTFD), has good signal representation and is appropriate for analysis of nonstationary, multicomponent signals The extraction of coherent structures makes MP an attractive tool for TF representation...
Ngày tải lên: 23/06/2014, 01:20
Báo cáo y học: "A new approach for the large-scale generation of mature dendritic cells from adherent PBMC using roller bottle technology" ppt
... floating cells were harvested and stained for DC maturation markers without fixation Immediately before FACS analysis µg/ml 7-ADD was added as viability indicator The dot plots shown the total ... T-cell-based immune responses against viral disease and cancer [1] Recently, this powerful ability of DC is being tested as an active vaccine approach to treat cancer and viral infections such as ... 3H-thymidine was added to each well and the plates harvested 18 h later Irradiated PBMC from the original DC donor were also used as stimulators as a control The average cpm and standard deviation of...
Ngày tải lên: 11/08/2014, 10:23
Báo cáo khoa học: "A The Molecular Adsorbent Recirculating System (MARS®) in the intensive care unit: a rescue therapy for patients with hepatic failure" pdf
... remains stable and, in particular, MARS® did not enhance fibrinolysis Conclusion The concept of albumin dialysis in patients with end-stage liver disease is a novel approach Albumin dialysis with ... Castaing D, Samuel D: Extracorporeal liver support using the MARS® Albumin dialysis system: a rescue therapy in patients with end-stage liver disease and renal failure Liver Transpl 2005, 11:Abs ... 8:43-50 Iwai H, Nagaki M, Naito T, Ishiki Y, Murakami N, Sugihara J, Muto Y, Moriwaki H: Removal of endotoxin and cytokines by plasma exchange in patients with acute hepatic failure Crit Care Med 1998,...
Ngày tải lên: 12/08/2014, 23:21
Báo cáo y học: "Dialectical Behavioral Therapy for Adolescents (DBT-A): a clinical Trial for Patients with suicidal and self-injurious Behavior and Borderline Symptoms with a one-year Follow-up" pot
... Regarding aspects such as family, social contact with peers and physical health, a tendency towards amelioration was Fleischhaker et al Child and Adolescent Psychiatry and Mental Health 2011, ... suicidal adolescents Suicide Life Threat Behav 2002, 32:146-157 Katz LY, Cox BJ, Gunasekara S, Miller AL: Feasibility of dialectical behavior therapy for suicidal adolescent inpatients J Am Acad ... D, Heard HL: Cognitivebehavioral treatment of chronically parasuicidal borderline patients Arch Gen Psychiatry 1991, 48:1060-1064 Rathus JH, Miller AL: Dialectical behavior therapy adapted for...
Ngày tải lên: 13/08/2014, 18:21
optimization of protein and rna detection methodologies and a new approach for manipulating protein activity in living cells
... 5’PHOS-GAACCGGAGCCGCAGCACCCGGGGCAGCAAGGCATT 27 GGGAAGCTTGCCACCATGGGTGACTGGAGTGCCTTGGGGAAATTACTGG ACAAGG 28 AAAAGGTACCGACCGGTTGAACCGCAATCTCCAGGTCATCAG 29 ACCATGGCCGGATCCGCTCGGTGGTGCTGCCC 30 GGGCAGCACCACCGAGCGGATCCGGCCATGGT ... TTTTAAGCTTGCCACCATGGCCGGATCCTAAGCGGCCGCAGCAAGGGCGAGGAG CTG 10 CCCCATCGATCTCGAGTTACTTGTACAGCTCGTCCAT 11 ACCTACAGGTGGGGTCTTTCATTCCC 12 AGCTCGTTTAGTGAACCGTCAGATC 13 GACAAGCGGCCGCTTAAGAACCGC 14 AAACTCGAGTTAGCGGCCGCCCCTCCACATGCAG 15 AAAGCGGCCGCCAGAACCGCAGCACCCGGGGCA ... CCCAAGCTTGCCACCATGGTGAGCAAGGGCGAGGAG TTTGGATCCNNKNNKNNKTGCTGCCCCGGCTGCTGC TTTTGCGGCCGCCMNNMNNMNNGCAGCAGCCGGGGCAGCA AATACGACTCACTATAGGGA GTAATCCAGAGGTTGATTCTCGAGAAAA TTTTAAGCTTGCCACCATGGCCGGATCCTAAGCGGCCGCAGCAAGGGCGAGGAG...
Ngày tải lên: 13/11/2014, 10:46
Performance management a new approach for driving business results
... straightforward and easy to implement that they miss what it really takes to gain value and results from a performance management process What happens is that “flavor of the day” performance management ... made it easier for managers to match their observations of employee performance to a rating scale point Today, well-defined behavioral standards remain a hallmark of effective performance management ... Employees and Managers Evaluate and Continually Improve the System Assess Quality Using a Formal Performance Management Review Assess Alignment with Related HR Decisions Evaluate User Reactions Practical...
Ngày tải lên: 25/11/2016, 09:40
Báo cáo y học: "Carotid intima-media thickness and endothelial function: useful surrogate markers for establishing cardiovascular risk in patients with inflammatory rheumatic disease" pdf
... cardiovascular events in patients with rheumatoid arthritis Semin Arthritis Rheum 2008 [Epub ahead of print] Gonzalez-Juanatey C, Llorca J, Garcia-Porrua C, SanchezAndrade A, Martín J, Gonzalez-Gay ... carotid intima-media thickness and atherosclerosis in rheumatoid arthritis Arthritis Res Ther 2008, 10:102 Gonzalez-Juanatey C, Llorca J, Martin J, Gonzalez-Gay MA: Carotid intima-media thickness ... Arthritis Research & Therapy Vol 10 No Gonzalez-Gay et al Taking all of these considerations into account, we support the use of surrogate markers to determine the cardiovascular risk of patients...
Ngày tải lên: 09/08/2014, 10:23
báo cáo khoa học: "The importance of organizational characteristics for improving outcomes in patients with chronic disease: a systematic review of congestive heart failure" pdf
... performed using Stata 9.2 (College Station, Texas) Analysis contrasting CAS characteristics associated with effectiveness for CHF and diabetes The relationship between each individual CAS characteristic ... Zimmerman L, Agrawal S: Comparison of Health Buddy with traditional approaches to heart failure management Family and Community Health 2003, 26(4):275-88 Page of 10 49 Barnason S, Zimmerman L, ... M, Paul S, Baines J, Gisborne L, Farooqi A, Luan X, Squire I: Disease management programme for secondary prevention of coronary heart disease and heart failure in primary care: a cluster randomised...
Ngày tải lên: 10/08/2014, 10:23
Báo cáo y học: "Adalimumab - an effective and promising treatment for patients with fistulizing Crohn’s disease: a case series" pdf
... of patients with fistulas treated with adalimumab, along with an evaluation of the two-year maintenance of fistula closure during treatment with adalimumab (ADHERE trial) [7] This analysis has ... therapy [7,8] The ACCENT II trial assessed the efficacy of infliximab maintenance therapy in adult patients with CD who had at least one draining abdominal or peri-anal fistula over a period of at ... fistulas per day among patients treated with adalimumab by comparison with patients treated with a placebo during the double-blind treatment period (0,88 for the adalimumab group versus 1,34 for...
Ngày tải lên: 11/08/2014, 00:23
Báo cáo y học: " Systems biology coupled with label-free high-throughput detection as a novel approach for diagnosis of chronic obstructive pulmonary disease" pptx
... vision, as others have also adopted this strategy as a way forward in molecular analysis Alagaratnam et al are utilising Bayesian approaches to pursue muscular dystrophy diagnosis [223] Similarly, ... other arbitrary measures for disease classification Adopting a systems biology approach, whereby a disease defining molecular fingerprint is analysed, would increase the accuracy of disease diagnosis, ... Iio K, Tanimoto Y, Kanehiro A, Okada C, Soda R, Takahashi K, Tanimoto M: Inflammatory markers in exhaled breath condensate from patients with asthma Respirology 2008, 13(5):654-663 Fagan KA, McMurtry...
Ngày tải lên: 12/08/2014, 14:20
A new approach to semantic and syntactic functions of English adjectives – A contrastive analysis with their Vietnamese equivalents
... now C .A plays an important role in learning a foreign language as a main subject at most language universals According to C James (1980;19), C .A is a form of inter-language study and a central concern ... implications 2.2.2 Gradable and non- gradable adjectives According to L G Alexander (1988, 108) adjectives can be also divided into gradable and non- gradable Gradable adjectives mean a large class ... connection with health such as a faint chance, a faint hope _ Predicative adjectives beginning with aThe following adjectives are used only predicatively like afloat, afraid, alight, alike, alone, ashamed,...
Ngày tải lên: 10/04/2013, 14:46
INTERACTIONS OF POLYMERS WITH FIBRILLAR STRUCTURE OF CELLULOSE FIBRES: A NEW APPROACH TO BONDING AND STRENGTH IN PAPER docx
... improving paper strength and formation (Swanson 1950) Guar gum is a branched galactomannan polymer which has a linear 1-4 -D-mannan backbone with 1-6-linked -D-galactose side groups on approximately ... paper, or any material, are extremely important for manufacturers and end-users, as well as in recycling Tensile, tear, and internal strength of paper are standard measures for the mechanical ... kuivatuksen aikana oli tunnusomaista eri polymeereillä ja adsorptioolosuhteilla Karboksimetyyliselluloosan ja ksyloglukaanin adsorption aiheuttama kuitujen pintafibrilleiden dispergointi ja plastisointi...
Ngày tải lên: 18/03/2014, 02:20
A Study on the Effects of Argentine Tango as a Form of Partnered Dance for those with Parkinson Disease and the Healthy Elderly pptx
... for their assistance with this study This work was supported by a grant from the Marian Chace Foundation to Madeleine Hackney and a grant from the American Parkinson Disease Association to Gammon ... conditions Changes with dual task walking are greater in those with PD than those without and dual tasking may trigger freezing in individuals with PD (Giladi and Hausdorff 2006) Gait and balance difficulties ... movement approaches, employing dance as the principle intervention, that are both enjoyable and effective in addressing balance, turning and gait difficulties associated with aging Dance for those with...
Ngày tải lên: 28/03/2014, 20:20
A new approach to financial regulation: the blueprint for reform potx
... undertake, as far as possible before formal legal powers are created, the permanent body’s macro-prudential role, in addition to vital preparatory work and analysis into potential macro-prudential ... cultural changes arising from the creation of a specialist authority will be a vital part of achieving the objectives of the reform In particular, the FCA will take a more proactive approach to dealing ... Bank and the FSA are engaging in Europe and with international partners on this and other crucial issues A new approach to financial regulation 1.13 The Government’s primary objective in reforming...
Ngày tải lên: 29/03/2014, 18:20
báo cáo hóa học:" A practical approach for the validation of sterility, endotoxin and potency testing of bone marrow mononucleated cells used in cardiac regeneration in compliance with good manufacturing practice" docx
... Ikeda U, Shintani S, Masaki H, Amano K, Kishimoto Y, Yoshimoto K, Akashi H, Shimada K, Iwasaka T, Imaizumi T: Therapeutic angiogenesis for patients with limb ischaemia by autologous transplantation ... clinically Unlike pharmaceutical products, many stemcell-based products may originate in academic laboratories where researchers are unfamiliar with the applicable regulations As new stem-cell-based ... bonemarrow cells: a pilot study and a randomised controlled trial Lancet 2002, 360(9331):427-435 Miyamoto K, Nishigami K, Nagaya N, Akutsu K, Chiku M, Kamei M, Soma T, Miyata S, Higashi M, Tanaka...
Ngày tải lên: 18/06/2014, 15:20