... editorial board of Eating Disorders: The Journal of Treatment and Prevention A Fellow of the Academy for Eating Disorders, he is a former board president of the National Eating Disorders Association, ... on eating disorders treatment, research, professional training, eating disorders in men, and the challenges of integrating science and practice He is also a member of the Academy for Eating Disorders ... therapist for The Renfrew Center of Florida She is a trustee of the Marian Chace Foundation, a past president of the American Dance Therapy Association, and a past Chair of The National Coalition...
Ngày tải lên: 12/02/2014, 16:20
... and technology (KNUST) generates a colossal amount of waste (solid and liquid) The solid waste is dumped at a site far away from the inhabited part of campus and the liquid waste is sent to a ... potential of the sewage at the Primary Sedimentation Tank (PST) at the KNUST sewage treatment plant and its potential power production Feedstock analysis 2.1 Wastewater handling at KNUST Liquid waste ... Poliafico M Anaerobic Digestion Support Software, Cork Institute of Technology, 2007 [7] Barelli D., Csambalik L., Mestas C and Santos D Economical and Environmental Analysis of a Biogas Plant...
Ngày tải lên: 05/09/2013, 16:11
Báo cáo khoa học: A strategy for the generation of specific human antibodies by directed evolution and phage display An example of a single-chain antibody fragment that neutralizes a major component of scorpion venom docx
... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTAATTTTATGCTGACTCAGCCCCA CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTGCC CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAAGAGACGGTGACCATTGTCCC CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTTCC ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCGTGATGACCCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAACGACACTCACGCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAATTGTGCTGACTCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTCAGCTCGTGTTGACGCAGCCGCC ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCCAGATGACCCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGATGTTGTGATGACTCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAATTGTGTTGACGCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCGTGATGACCCAGTCTCC...
Ngày tải lên: 23/03/2014, 13:20
Edward Barnett; a Neglected Child of South Carolina pot
... and patiently awaiting the arrival of the father A step approached, it was not the man, however, but the landlady's wayward nephew: he, too, carried a basket, and seemed pleased, but not at all ... old seaman and Edward Barnett, the village landlady's eccentric nephew CHAPTER VI 20 'A plague upon my awkward riding,' said the seaman, 'we are too late! They have taken him, and that rascal too ... a strange anomaly an American a British peer.' 'And then, dear grandfather, you will allow me to repay you, in a small measure, by my affection and care of your declining years, for all the anxiety...
Ngày tải lên: 30/03/2014, 00:20
Báo cáo khoa học: Inactivation of phosphorylase is a major component of the mechanism by which insulin stimulates hepatic glycogen synthesis doc
... wide range of activities of phosphorylase a; (b) that suppression of GSK-3 activity, in the absence of inactiva- tion of phosphorylase, causes a large activation of glycogen synthase but a small ... preparations indicated Statistical analysis was by Student’s paired t test Fig Time course of inactivation of phosphorylase a (A) and activation of glycogen synthase (B) by 10 nM insulin Hepatocytes ... phosphorylase inactivator, we suggest that additional factors may be involved in translocation of glycogen synthase and that phosphorylase a itself may be an important determinant of the subcellular...
Ngày tải lên: 31/03/2014, 01:20
báo cáo hóa học:" A comprehensive review of 46 exercise treatment studies in fibromyalgia (1988–2005)" ppt
... there was a natural break in the data at a certain number of classes This is problematic in that the "dose" of the intervention was not generally attainable Outcome measures The outcome measures ... Fibromyalgia: a randomised, controlled trial of a treatment programme based on self management Ann Rheum Dis 2004, 63:290-6 Fontaine KJ, Haaz S, Bathon J: Promoting physical activity in fibromyalgia ... comorbidities such as plantar fasciitis, ankle tendonitis, knee osteoarthritis and a myriad of psychological stigma regarding appearance) • There is a lack of couples or family based exercise studies...
Ngày tải lên: 20/06/2014, 16:20
Báo cáo y học: "Urokinase, a constitutive component of the inflamed synovial fluid, induces arthritis" pps
... Histopathological appearance of arthritis after intra-articular injection of low molecular weight urokinase plasminogen activator (LMW-uPA) (a) Arthritic knee joint days after the LMW-uPA injection ... demonstrated that uPA, a constitutive component of inflamed synovial fluid in RA patients, is proinflammatory and may be responsible for an induction/perpetuation of intra-articular inflammation In addition, ... Kikuchi H, Shimada W, Nonaka T, Ueshima S, Tanaka S: Significance of serine proteinase and matrix metalloproteinase systems in the destruction of human articular cartilage Clin Exp Pharmacol Physiol...
Ngày tải lên: 09/08/2014, 01:21
Handbook of Eating Disorders - part 1 pdf
... Medical Association, 282, 1530–1538 APA (1980) Diagnostic and Statistical Manual of Mental Disorders (3rd Edition) Washington, D.C.: American Psychiatric Association APA (1994) Diagnostic and Statistical ... nervos: An ominous variant of anorexia nervosa Psychological Medicine, 9, 429–448 Santonastaso, P., Zanetti, T., Sala, A. , Favaretto, G., Vidotto, G & Favaro, A (1996) Prevalence of eating disorders ... Cognitive-Behavioural Models Roz Shafran and Padmal de Silva 121 Chapter Sociocultural Theories of Eating Disorders: An Evolution in Thought Mervat Nasser and Melanie Katzman 139 Chapter Psychological Factors...
Ngày tải lên: 10/08/2014, 20:21
Handbook of Eating Disorders - part 2 pptx
... homeostasis, additional components of already identified pathways and guide candidate gene analyses in human studies A fundamental flaw in current research strategies can in part explain the lack of ... basis for more rational pharmacological treatment and/or preventative therapeutic strategies for eating disorders and obesity REFERENCES APA, (1994) Diagnostic and Statistical Manual of Mental ... DYSREGULATION OF APPETITE AND WEIGHT HOMEOSTASIS IN EATING DISORDERS Anorexia Nervosa Anorexia Nervosa and Appetite Anorexia nervosa (AN) is clearly a disorder of under -eating, but the question of whether...
Ngày tải lên: 10/08/2014, 20:21
Handbook of Eating Disorders - part 3 pps
... found a 17% reduced SERT availability in hypothalamus and thalamus and a similar reduction in striatal DAT availability In addition, there was a negative correlation between illness duration and ... psychotherapy than are preoccupied or secure patients, at least by the time of discharge As idealisation is the hallmark of the D individual, and idealisation was associated with an eating disorder diagnosis, ... psychopathology across all the eating disorders, i.e anorexia nervosa, bulimia nervosa and atypical eating disorders (Fairburn, Cooper & Shafran, in press) Evaluation of Models Some of the above...
Ngày tải lên: 10/08/2014, 20:21
Handbook of Eating Disorders - part 4 docx
... twice as high as in an age-matched population and perinatal mortality was increased by a factor of Willis and Rand (1988) reported a miscarriage rate increased by a factor of There is also evidence ... Stice, E., Akutagawa, D., Gaggar, A & Agras, S (2000) Negative affect moderates the relation between dieting and binge eating International Journal of Eating Disorders, 27, 218–229 Stone, A. A & Brownell, ... obtain an androgynous physique at a time when men are still viewed as more powerful, as a means of demonstrating mastery and control, and of course a realistic adaptation to the availability of fashionable...
Ngày tải lên: 10/08/2014, 20:21
Handbook of Eating Disorders - part 5 doc
... elevated abdominal adipose tissue contributes to an exaggerated release of free fatty acids (FFA) This elevation of FFA leads to an inappropriate maintenance of glucose production and impaired ... the baby (Blais et al., 2000) Nonetheless women with bulimia nervosa are at risk of having small babies, and have higher rates of Caesarian sections and perinatal problems The risk of postnatal ... M.L., Agras, W.S & Gould, R .A (1999) Bulimia nervosa: A meta analysis of psychosocial and pharmacological treatments Behav Ther., 30, 117–135 CHAPTER 13 Assessment and Motivation Janet Treasure...
Ngày tải lên: 10/08/2014, 20:21
Handbook of Eating Disorders - part 6 ppsx
... schema-change strategies can target meanings that are held in verbally, visually and somatically accessible modalities, each of which interacts with affect and motivation Finally, Safran and Segal ... development of a measure to assess coping with negative affect by eating International Journal of Eating Disorders, 18 79–90 Baker, D .A & Sansone, R .A (1997) Treatment of patients with personality disorders ... acceptance and change Zen is full of paradox and again there is something paradoxical in the idea that acceptance—for instance, of unchangeable traumatic events in the past—may be necessary for change...
Ngày tải lên: 10/08/2014, 20:21
Handbook of Eating Disorders - part 7 pdf
... 79–85 La Via, M.C., Gray, N & Kaye, W.H (2000) Case reports of Olanzapine treatment of anorexia nervosa International Journal of Eating Disorders, 27, 363–366 Lean, M.E.J (1997) Sibutramine: A review ... Finally, the 286 CLAIRE TANNER AND FRANCES CONNAN flexibility of CAT means that it can be generalized to a variety of settings, including inpatient treatment and family work Much of the rationale ... was of a five-year follow-up of 25 adolescent anorexia nervosa patients (mean age 14.9 years) with a short duration of illness (mean 8.1 months) At treatment termination there had been significant...
Ngày tải lên: 10/08/2014, 20:21
Handbook of Eating Disorders - part 8 pdf
... (Ramsey et al., 1999) THE INPATIENT TREATMENT OF BULIMIA NERVOSA This is a complex area and differs from that of anorexia nervosa As with anorexia nervosa, there are national variations: for example, ... that various issues such as lack of information about eating disorders, fears about physical frailty and adverse attitudes to eating disorder patients among staff can be addressed At the Royal Free ... Treating eating disorder patients in a managed care environment: Contemporary American issues and a Canadian response The Psychiatric Clinics of North America, 19, 793–810 CHAPTER 21 Day Treatments...
Ngày tải lên: 10/08/2014, 20:21
Handbook of Eating Disorders - part 9 pptx
... Type of diabetes female female male/female female female female male/female female male/female male/female female male/female female female male/female female male/female male/female female male/female ... 24.1) EATING DISORDERS AMONG DANCERS Eating disorders are common among dancers (le Grange et al., 1994) Abraham (1996) examined the eating patterns of 60 young (mean age 17 years) female ballet dancers ... type type Type of diabetes female female female male/female male/female female female male/female female male/female female female female female male/female male/female male/female female Gender...
Ngày tải lên: 10/08/2014, 20:21
Handbook of Eating Disorders - part 10 pptx
... weight and shape Other signals can be anaemia, constipation, fatigue, dehydration, dry skin, brittle hair and nails and dental problems Important signals for bulimia nervosa are abrasions and scars ... amenorrhoea 177–8 amitriptyline 313 amphetamines 318 amylase, serum 173 AN see anorexia nervosa AN/BP see binge purging anorexia nervosa anger 160 anorexia, true anorexia athletica 386 anorexia nervosa ... many prevention programmes or health-promoting interventions have become stuck, not because of a lack of goals and objectives, but of a lack of a theoretical framework as well as adequate strategies...
Ngày tải lên: 10/08/2014, 20:21
báo cáo khoa học: " The NAC domain-containing protein, GmNAC6, is a downstream component of the ER stress- and osmotic stress-induced NRP-mediated cell-death signaling pathway" pptx
... Fujita M, Oono Y, Kamiya A, Nakajima M, Enju A, Sakurai T, Satou M, Akiyama K, Taji T, YamaguchiShinozaki K, Carninci P, Kawai J, Hayashizaki Y, Shinozaki K: Monitoring the expression profiles of ... NAC (NAM, ATAF1, ATAF2 and CUC2) domaincontaining proteins NAC proteins are plant specific transcriptional factors that are involved in a variety of developmental events as well as in biotic and ... soybean leaves with the incompatible bacterium, Pseudomonas syringae patovar tomato (Additional file 3), as our experimental system Levels of GmNAC6 mRNA were examined at various times after treatment...
Ngày tải lên: 11/08/2014, 11:21
Evidence based Psychological Interventions in the Treatment of Mental Disorders A Literature Review
... systematic observation to accurately assess mental disorders and develop a diagnostic formulation, select a treatment strategy, and to collaboratively set goals of treatment with consideration of a ... likelihood of relapse compared to medication 13 mental disorders: Adult Title of paper A randomized controlled trial of cognitive behavioural therapy as an adjunct to pharmacotherapy in primary care based ... Therapy (CBT) Title of paper A meta-analysis of the efficacy of psycho- and pharmacotherapy in panic disorder with and without agoraphobia Authors and journal Mitte, K (2005) Journal of Affective...
Ngày tải lên: 02/06/2014, 09:39