Modern method for guitar 1
... 83, 91, 97 105, 107, 110, 116, 121 R i g h t hand technique for rhy ace 69 Basic latin beat 88 F U N D A M E N T A L S Primary information 3, 4, 12 Sharps and flats 15, 100, 113 Eighth ... pupil and almost all parts will musically stand alone I have not included any "old favorites" as guitar arrangements of these songsare available in many existing publications (Also, you ... 81 " " D " 91 11 " A " 101 CHORD ETUDES 01, #2, #3, 14, #5 62, 72, 87, 93 101 CHORD FORMS (RHYTHM ACCOMPANIMENT) Introduction to 11 Baas notes and chords 17
Ngày tải lên: 16/08/2013, 08:28
Modern method for guitar 2
... something already learned. pos-All music is again original and has been created especially for the tation and perfection of the lesson material. presen-Please be advised that the pages devoted ... music for guitar players in general. As before, good luck and have fun. William G Leavitt Trang 6ALL SCALES (MAJ and MIN etc ) WILL BE DERIVED FROM THESE FOURBASIC MAJOR SCALE FINGERING PATTERNS ... ULTIMATELY 5 MAJOR KEYS WILL BE POSSIBLE IN EACH POSITION WITH TYPE 1 AND ITS' FOUR DERIVA- TIVE FINGERING PATTERNS - 1A, 1B, 1C, AND 1D THIS SAME FACT APPLIES TO TYPE 4 WITH ITS' DERIVATIVES 4A,
Ngày tải lên: 16/08/2013, 08:28
... Trang 1Volume 2010, Article ID 976913, 10 pagesdoi:10.1155/2010/976913 Research Article A New Method for Least-Squares and Minimax Group-Delay Error Design of Allpass Variable Fractional-Delay ... 0.001141 0.0000365 196.56 Z −1 −1 Z −1 Z −1 Z −1 Z −1 Z −1 a5 (p) a4 (p) a3(p) a2 (p) a1 (p) (a) p a(n, 4) a(n, 3) a(n, 2) a(n, 1) a n(p) (b) Figure 1: (a) The proposed structure of an allpass ... −0.232515100469996 −0.110719224055686 −0.019869040384123 10 0.065857103009291 0.190720077751894 0.214249655962206 0.109824100478193 0.021858526125015 11 −0.054726435065962 −0.165033191450544 −0.194914864048044
Ngày tải lên: 21/06/2014, 07:20
... nos 113572, 118355, 134767, and 213462 References [1] M A Maddah-Ali, A Mobasher, and A K Khandani, “Fairness in multiuser systems with polymatroid capacity region,” IEEE Transactions on Information ... Trang 1Volume 2010, Article ID 395763, 10 pagesdoi:10.1155/2010/395763 Research Article A Novel Method for Improving Fairness over Multiaccess Channels Seyed Alireza Razavi and Ciprian Doru ... min,i+1 To verify the inequality, we note that Rmin,i+1 = Pmin,i+1 Πi+1 log 1 +Πi+1 N i+1 (A.8) < P min,i+1 Πi+1 log 1 +Πi+1 N i+1 (A.9) < P min,i+1 Π i+1 log 1 +Π i+1 N i+1
Ngày tải lên: 21/06/2014, 11:20
Báo cáo hóa học: "Research Article A Computationally Efficient Method for Polyphonic Pitch Estimation" pdf
... Trang 1EURASIP Journal on Advances in Signal ProcessingVolume 2009, Article ID 729494, 11 pages doi:10.1155/2009/729494 Research Article A Computationally Efficient Method for Polyphonic ... vector machines [9, 10] Other methods such as Bayesian inference [11–13], sparse coding [14], and nonnegative matrix factorization [15] have also been investigated More detailed reviews on the state ... filter bank, it is faster than any other filter-bank-based implementation The Fast RTFI is also compared with transform-based implementations as follows So as to use a constant-Q transform for a joint
Ngày tải lên: 21/06/2014, 19:20
Báo cáo hóa học: " A New Method for Estimating the Number of Harmonic Components in Noise with Application in High Resolution Radar" pdf
... subspace approach to multiple emitter location and spectral estimation, Ph.D thesis, Stanford University, Stanford, Calif, USA, 1981 [3] A Paulraj, R Roy, and T Kailath, “A subspace rotation approach ... is based on the original idea which consists in reformulating the estimation problem as a classification problem with two classes An analytical demonstration is provided for a special case of a ... Autocorrelation matrix eigenvalues 3.5 2.5 1.5 0.5 6 10 11 k 10 11 k (a) (b) Figure 1: Variation of the autocorrelation matrix eigenvalues for superimposed sinusoids corrupted by white Gaussian noise,
Ngày tải lên: 23/06/2014, 01:20
Everyone Is a Customer - A Proven Method for Measuring the Value of Every Relationship in the Era of Collaborative Business pdf
... Have We Learned? 109 Trang 141 ❚ Measuring the Value of Every Relationship 111Valuing Relationship Currencies 112 The Relationship Scorecard 114 Using the Process 118 Digging Deeper 123 Interpreting ... mantra—collaborate, collaborate, collab-orate But what is collaboration and why is everyone talking about it? Collaboration has many meanings, depending with whomyou speak Some call collaboration the ability ... countriessuch as Pakistan that previously supported the Taliban Fearinginstability, Pakistan offered information about, and access to, theTaliban and Afghanistan to the United States In return,
Ngày tải lên: 28/06/2014, 22:20
Báo cáo khoa hoc:" A rapid method for computing the inverse of the gametic covariance matrix between relatives for a marked " pdf
... be assigned to the unknown parentsand the problem becomes a pedigree with incomplete marker data For incom-plete marker data, alternative exact and approximate approaches are available Trang 11(Wang ... Trang 1© INRA, EDP Sciences, 2001Original article A rapid method for computing the inverse of the gametic covariance matrix between relatives for a marked Quantitative Trait Locus Gamal ABDEL-AZIM∗, ... rth row of A by A(r, ) and the entire cth 2.1 Tabular method for G Where s and d denote paternal and maternal parents, respectively, of Trang 4156 G Abdel-Azim, A.E Freemanof individual i descended
Ngày tải lên: 09/08/2014, 18:21
everyone is a customer a proven method for measuring the value of every relationship in the era of collaborati phần 5 pdf
... hands.Now let’s see how we characterize each of the four rela-tionship types shown in Figure 5.1 Trang 11TRANSACTIONAL RELATIONSHIPSA transactional relationship is a non-core relationship thathas ... lremain-andlord mremain-akes sure you hremain-ave occupremain-ancy of therented space as specified in the lease Having a transactional re-lationship does not imply anything about your relationshipother ... transactional relationships, even if they arenot core It is also important to appreciate that a relationship ing in the transactional quadrant over the long run is perfectlyacceptable and in fact expected
Ngày tải lên: 10/08/2014, 11:20
Báo cáo y học: "Immobilized pH gradient-driven paper-based IEF: a new method for fractionating complex peptide mixtures before MS analysis" pdf
... MPC 117:114 vs OGE Log HSF6: MPC 117:114, r = 0.8987; PIEF Log HSF6 : SFC 117:116 vs OGE Log HSF6 : SFC 117:116, r = 0.9116; PIEF Log MPC : SFC 114:116 vs OGE Log MPC : SFC 114:116, r = 0.9100 Although ... PIEF and OGE, we further analyzed our data via mean vs difference plots of Bland and Altman (for exam-ple, see Figure 9 for 117:116) Similar plots were obtained for the other ratios The standard ... one method alone Overall, our data demonstrate that PIEF and OGE cannot substitute for one other; rather, the methods are complementary Accuracy of iTRAQ Ratios Known amounts of a particular complex
Ngày tải lên: 13/08/2014, 13:20
ADVANCES IN QUANTITETIVE ANALYSIS OF FINANCE AND ACCOUNTING Volume 1 pdf
... 206 annual interest rate, 65, 66, 69, 70 H hedge ratios, 129–131, 135–140, 142, 145–147, 149 hedging, 129–131, 135, 136, 138–140, 147–149 B beta, 153, 155, 158, 160–169 I index securities, 105–107, ... 89, 90 exchange traded funds, 105 exchanges, 171–176, 178–180, 183 M marketing, 33, 36 moment matching, 1, 2, 4, 5, 7–10, 13 multinomial, 1–6, 9, 10, 12, 13 N NASDAQ, 171–183 NASDAQ market system, ... Strategic Operating Information and the Accuracy of Analysts’ Earnings Forecast; CFA Designation, Geographical Location and Analyst Performance Finally, the other three papers are 1: Value-Relevance of
Ngày tải lên: 23/03/2014, 12:20
A Half-Century of Conflict, Volume II pdf
... day as a separate community. Their enemies the Chickasaws, Osages, Arkansas, and even the distant Illinois, waged such deadly war against them that, according to La Harpe, the unfortunate Nassonites ... Rigaud de Vaudreuil His Great War-Party He attacks Fort Massachusetts Sergeant Hawks and his Garrison A Gallant Defence Capitulation Humanity of the French Ravages Return to Crown Point Peace ... gradually diminished this erratic spirit, and at the same time impaired the qualities that were associated with it. The Canadian became a more stable colonist and a steadier farmer; but for forest
Ngày tải lên: 24/03/2014, 03:21
USAID Supported a Wide Range of Child and Maternal Health Activities, but Lacked Detailed Spending Data and a Proven Method for Sharing Best Practices pptx
... USAID’s CS/MH allocations for fiscal years 2004 and 2005 (See app II for amounts and percentages allocated in each of the USAID Allocated Most CS/MH Funds to Africa, Asia, and Latin America and ... Coordination 20 missions 2 regional missions Office of the Administrator 8 missions Bureau for Global Health Bureau for Africa Bureau for Asia and the Near East Bureau for Latin America and the Caribbean ... that received CS/MH funds Bureau for Global Health, $133.1 Asia and the Near East, $160.0 Latin America and the Caribbean, $78.5 International partnerships, $136.5 Note: In addition, USAID allocated
Ngày tải lên: 28/03/2014, 09:20
Báo cáo khoa học: "A Bayesian Method for Robust Estimation of Distributional Similarities" pot
... Trang 1A Bayesian Method for Robust Estimation of Distributional SimilaritiesJun’ichi Kazama Stijn De Saeger Kow Kuroda Masaki Murata† Kentaro Torisawa Language Infrastructure Group, MASTAR ... priors are Dirich-let, and the base similarity measure is the Bhat-tacharyya coefficient (BhatBhat-tacharyya, 1943), we can derive an analytical form for Eq 2, that en-ables efficient calculation ... can be regarded as another way of treating data sparseness BC The Bhattacharyya coefficient (Bhat-tacharyya, 1943) between p(f k |w1) and p(f k |w2) This is the baseline for BCb BCa The Bhattacharyya
Ngày tải lên: 30/03/2014, 21:20
a novel method for the synthesis of cao nanoparticle
... decomposition applications of nanosized metal oxides such as MgO, AP-CuO, AP-Fe2O3, AP-Al2O3 and AP-CaO [15-20] There are several methods for the synthesis of nanoscale CaO, including sol-gel[21], gas phase ... with CaO nanoparticles For this purpose, 10 μL of 2-CEPS, 5 mL of isopropanol or heptane as solvent and 10 μL of toluene as internal standard and 5, 50, 100 Trang 4and 150 mg of CaO nanoparticles/Polyvinyl ... the CaO nanoparticles/Polyvinyl pyrrolidone (PVP) is shown The peaks at 1632 and 1493 cm-1 are assigned to CO2 absorbed on the surface of nanoparticles The peaks at 1350 and 898 cm-1 are assigned
Ngày tải lên: 06/05/2014, 08:55
Báo cáo hóa học: " A novel method for neck coordination exercise – a pilot study on persons with chronic non-specific neck pain" docx
... condition ranged from 11 to 20 Therefore, for block 1–11 n = 14 and for block 12–20 n = 13, 11, 11, 10, 9, 8, 6, 3 and 1 respectively For each box plot, the whiskers represent maximum and minimum values, ... read and approved the final manuscript Additional material Acknowledgements The authors would like to thank Nisse Larson for excellent engineering assistance, Maria Frykman for valuable assistance ... p-value Postural sway Ra area (cm 2 ) 4.27 ± 1.44 3.59 ± 1.79 0.387 Tr area (cm 2 ) 1.61 ± 0.67 1.14 ± 0.75 0.019* Cervical Rotation ROM for left + right rotation (degrees) 142 ± 18.3 140 ± 16.7
Ngày tải lên: 19/06/2014, 08:20
Tài liệu Báo cáo khoa học: A facile method for expression and purification of the Alzheimer’s disease-associated amyloid b-peptide pdf
... primers: Aba, 5¢-ATGGACGCTGAAT TCCGTCACGACTCTGGTTACGAAGTTCACCACCAG AAGCTGGTG-3¢;Abb, 5¢-GTTCACCACCAGAAGCT GGTGTTCTTC GCTGAA GACGT GGGTTCT AACAAG GGTGCT-3¢;Abc, 5¢-CACAACGCCACCAACCATCAGA CCGATGATAGCACCCTTGTTAGAACCCAC-3¢;Ab- start, ... 5¢-CACAACGCCACCAACCATCAGA CCGATGATAGCACCCTTGTTAGAACCCAC-3¢;Ab- start, 5¢-GCGTAGGGTCGACATATGGACGCTGAATT CCGTCACG-3¢;Abstop, 5¢-CCTGCCGAGCTCCTATTA CACAACGCCACCAACCATCAG-3¢. The PCR solution was prepared in the buffer supplied with ... than A b40 [32–34]. The morphol- ogy of aggregates formed after incubation times when the aggregation had reached a maximum [5 h for Ab(M1–40) and Ab (1 40) and 80 min for Ab(M1–42) and Ab (1 42)]...
Ngày tải lên: 18/02/2014, 13:20
Tài liệu Báo cáo khoa học: Development of a new method for isolation and long-term culture of organ-specific blood vascular and lymphatic endothelial cells of the mouse pdf
... tsA58T Ag cDNA carry- ing the A4 38V mutation were PCR-amplified from COS-7 cDNAs using the following primers: LTA-1F, 5¢-CTC GAGATGGATAAAGTTTTAAACAGAG-3¢ and LTA- 1R, 5¢-TGAAGGCAAATCTCTGGAC-3¢ for ... 250 kDa 15 0 kDa 10 0 kDa 10 0 kDa 75 kDa 50 kDa 10 0 kDa 75 kDa Lyve -1 Prox -1 VEGFR-3 tsA58 T Ag / tublin Lyve -1 DaAPI DaAPI Lyve -1 Prox -1 CDa 31 DaAPI Magnetic A B C D E immunosorting ... Oreda B et al. (2003) The conditional inactivation of the beta-catenin gene in endothelial cells causes a defective vascular pattern and increased vascular fragility. J Cell Biol 16 2, 11 11 11 22. 8...
Ngày tải lên: 18/02/2014, 17:20
Tài liệu Building a Cisco Network for Windows 2000 P1 pdf
... Catalyst 5000 409 Software Features of the Catalyst 5xxx Series 410 Catalyst 6000 410 Hardware Features of the Catalyst 6xxx Series 410 Software Features of the Catalyst 6000 Series 411 Catalyst ... my grandfather, Arthur Conat, drove a carriage with horses when he was a teenager. He didn’t have a TV, or a telephone, or a car, or a refrigerator, or a washing machine, or running water aside ... not be able to accom- plish the goals he has set for himself. Stace Cunningham authored a chapter in addition to acting as technical director for the book. 71_ BCNW2K_FM 9 /10 /00 11 :57 AM Page viii xiv...
Ngày tải lên: 23/12/2013, 01:16
Tài liệu Green Buiding Handbook - Volume 1 pdf
... and beam frame system is that major alterations can easily be made and in this case the area of window on the south facade was changed without any additional cost after the main walls were up! Recycled ... heating Make use of passive and active solar energy wherever feasible Use passive and natural ventilation systems rather than mechanical (b) Minimising External Pollution and Environmental Damage for ... criteria. Stephen Wozniak has argued that several assessment systems are flawed in that they rely on an uneven collection of criteria that are not based on any logical evaluation. Quite different methods...
Ngày tải lên: 23/12/2013, 15:15
Bạn có muốn tìm thêm với từ khóa: