a model to detect driver distraction

... A3 A3 A3 A3 A2 A2 A2 A2 A1 Eye Car e Tr aining Modules H2 A1 A1 A1 Eye car e nur se Catar act sur geon Optometr ist Ophthalmologist Figure Example1of the use of a proposed modular training system ... for a planner to integrate all the interactions in a meaningful way To overcome this problem and to reduce uncertainty, a computable dynamic model is proposed from which a number of scenarios can ... immediate neighbours and the system as a whole The inclusion of feedback and temporal features makes the model dynamic and non-linear rather than static and linear Nurse, ophthalmology and community...

Ngày tải lên: 18/06/2014, 17:20

... high, saturated genetic maps would be necessary to have very close markers available each time in order to permit a molecular marker-assisted selection The current genetic maps contain around ... of around 80 chromosomes separated into two classes: a few distinguishable macrochromosomes and a much higher number of small microchromosomes, visualized as dots on metaphase preparations and ... genetic maps For this purpose, a collection of large insert BAC (bacterial artificial chromosome) and PAC (bacteriophage PI artificial chromosome) clones [80] to be used as microchromosome tags for...

Ngày tải lên: 09/08/2014, 18:21

... of America 2004, 101:6062–7 15 Ihaka R, Gentleman R: R: A Language for Data Analysis and Graphics Journal of Computational and Graphical Statistics 1996, 5:299–314 16 Team RDC: R: A Language and ... Kirschner MA, Arriza JL, Copeland NG, Gilbert DJ, Jenkins NA, Magenis E, Amara SG: The Mouse and Human Excitatory Amino Acid Transporter Gene (EAAT1) Maps to Mouse Chromosome 15 and a Region of ... that SpeCond is able to detect reliable tissue-specific genes and we evaluated its performance against alternative approaches In all cases, SpeCond displayed higher sensitivity and a lower false...

Ngày tải lên: 09/08/2014, 23:20

... resistance: A metabolic pathway to disease Hepatology 2005, 42:987-1000 Lonardo A, Lombardini S, Ricchi M, Scaglioni F, Loria P: Review article: hepatic steatosis and insulin resistance Aliment Pharmacol ... plasma was analysed for glucose, FFA and insulin as previously described [9] RQUICKI was calculated as described by Perseghin et al [7] Before statistical analysis, the data were divided into ... that study the influence of body condition at parturition on metabolism and performance during lactation was investigated Body condition was evaluated as described by Agenäs et al [10] and FFA,...

Ngày tải lên: 12/08/2014, 18:22

... treatment (Figure 2) TGCTTTCGGAGCGTATATC CCATGTTCAGGGTGTTCTCC GACTCCCTTCAGTGCTCCAG CCGGTAAGACTGGCTGATGT TGAGGGCCTTGTAAGTGAGC CACAAGGGCTGGTACTCCTG GCTTGTACATGCAGGACTGG CCGTGAGCCACTTCCATTAT GGGTCATCATCTCTGCTCCT ... Folgueira MAAK, Carraro DM, Brentani H, Patrão DFC, Barbosa EM, Netto MM, Caldeira JRF, Katayama MLH, Soares FA, Oliveira CT, Reis LFL, Kaiano JHL, Camargo LP, Vêncio RZN, Snitcovsky IML, Makdissi ... increased clinical response rates were associated with high histological grade [27,28] The histological grade seems to be of prognostic value in canine mammary carcinoma patients as in human patients...

Ngày tải lên: 12/08/2014, 18:22

... were applied A statistical model called multivariate linear mixed-effect model was applied to data established in three independent experiments as an illustrative example Multivariate linear mixed-effects ... that in a range from approximately 21-25C, temperature only had a modest effect on performance Tools to assess performance A performance tool can be defined as a tool or calculation method that ... for each indoor factor that varies) In practice, this is time consuming and difficult to do, so average assumptions are often applied A probabilistic model may be a more appropriate and an easier...

Ngày tải lên: 12/12/2016, 20:32

... contrast, the studies by Kawabata and Zeki (2004) and Skov ef al (2005) attempted to isolate those cortical structures that are actIvated more when a stimulus is evaluated as beautiful Presumably, ... processing along all five stages of the model The results indicate that evaluating a stimulus as beautiful was asSOCIated WIth mcreased activation in the orbital frontal cortex Activation in the orbital ... neural correlates of preference and beauty, two variables that have affective and cognitive components The areas activated by Vartanian and Goel (2004b) may have highlighted those cOrlical structures...

Ngày tải lên: 19/02/2014, 17:20

... negligible values (Brown et al., 1990; Dagan et al., 1993; Chen, 1996) To retain word type pairs that are at least twice as likely to be mutual translations than not, the threshold can be raised to Conversely, ... a constant property of the bitext 492 model is accurate, then A+ should be near and Ashould be near To find the most probable values of the hidden model parameters A+ and A- , we adopt the standard ... programs that induce them are generally available For each kind of evaluation, we have found one case where we can come close We induced a two-class word -to- word model of translational equivalence...

Ngày tải lên: 22/02/2014, 03:20

... A. I Technical report 540, M.I.T Artificial Intelligence Laboratory, Cambridge, MA A Yamada, T Yamamoto, H Ikeda, T Nishida, and S Doshita 1992 Reconstructing spatial image from natural language ... made up of transfers and relays Relays are abstract points initiating transfers and may be "covered" by a turn Landmarks can be either associated with relays or with transfers More formally, a ... (landmarks), or a turn and a landmark, mentioned in the text immediately one after •the other Concerning the ambiguity related to the location of landmarks, one can either choose an arbitrary...

Ngày tải lên: 08/03/2014, 07:20

... Chicago A Ratnaparkhi 1999 Learning to parse natural language with maximum entropy models Machine Learning, 34(1-3):151–175 B Roark 2001 Probabilistic top-down parsing and language modeling Computational ... experiment baseline grammar, no statistics grammar grammar, cheating 100-best oracle Conclusions and Outlook We have presented a language model based on a precise, linguistically motivated grammar, and ... with manageable complexity Our primary aim was to design a task which allows us to investigate the properties of our grammar-based approach and to compare its performance with that of a competitive...

Ngày tải lên: 17/03/2014, 02:20

... A state in this space is a partial alignment A transition is defined as the addition of a single link to the current state Any link which would create a state that does not violate any constraint ... parallel texts In Proceedings of the 4th Speech and Natural Language Workshop, pages 152–157 DARPA, Morgan Kaufmann Rebecca Hwa, Philip Resnik, Amy Weinberg, and Okan Kolak 2002 Evaluating translational ... algorithm that can handle many -to- one alignments This would involve training from an initial alignment that allows for many -to- one links, such as one of the IBM models Features that are related to multiple...

Ngày tải lên: 17/03/2014, 06:20

... programs Programs that might not otherwise be able to afford to design and pay for a rigorous evaluation are able to demonstrate their program impacts as they scale to size, and the government can ... for Planning and Evaluation, U.S Department of Health and Human Services (Washington: 2003), available at http://aspe.hhs.gov/hsp/ privatization-rpt03 5 Social impact bonds share several features ... and encourage learning 15 For a cautionary tale on the potential for manipulating social program performance indicators, see Pascal Courty and Gerald Marschke, “Measuring Government Performance:...

Ngày tải lên: 22/03/2014, 20:20

... from attacking dead targets (which also may lead to an overestimation of the damage to targeted systems) This too was not a limitation to the IOF Allocator but rather of the incoming data Finally, ... preprocessor again to create the input to the math solver The ability to make quick changes to the scenario also enables exploratory analyses and quick-reaction analyses Table B.1 Run-time Analysis ... a positive target Tanks are assigned a value of 10, and collateral targets are assigned a value equal to the negative of one tank (–10) There is an overkill factor of two in this example, meaning...

Ngày tải lên: 23/03/2014, 02:20

... Related Work Conversation can be seen as a collaborative activity to accomplish information-sharing and to pursue joint goals and tasks Under this view, agreeing on what has been said, and what ... demonstrated nonverbal conversational behaviors Empirical Study In order to get an empirical basis for modeling face -to- face grounding, and implementing an ECA, we analyzed conversational data in ... conversational agents (ECAs) has demonstrated that it is possible to implement face -to- face conversational protocols in human-computer interaction, and that correct relationships among verbal and...

Ngày tải lên: 23/03/2014, 19:20

... this approach was impractical because of the time and effort required to collect the necessary data In any case, an alternative technique which managed without a separate table of tag-pair error ... of tagpairs Instead of a separate tag-pair error likelihood table to assess the grammaticality, the same tag-pair frequency table is used for tag-assignment and error-detection The tag-pair frequency ... chosen grammatical tag; this likelihood is normalised relative to a threshold, so that values greater than one constitute "acceptable" grammatical analyses, whereas values less than one am indicative...

Ngày tải lên: 24/03/2014, 05:21

... all kinetoplastid CTs are unusual fusion proteins in having a cytidylyltransferase domain fused to a CDP-alcohol phosphatidyltransferase domain that is normally found in CEPT and CDP-ethanolamine:diacylglycerol ... in a mutant strain of Saccharomyces cerevisiae by the AUR1 gene J Biol Chem 272, 9809–9817 Kuroda M, Hashida-Okado T, Yasumoto R, Gomi K, Kato I & Takesako K (1999) An aureobasidin A resistance ... palmitoyl-CoA to form 3-ketosphinganine, a reaction catalysed by serine palmitoyltransferase After reduction of the product, dihydrosphinganine is N-acylated to dihydroceramide by a family of ceramide...

Ngày tải lên: 28/03/2014, 23:20

Ngày tải lên: 28/04/2014, 10:17

... e-parliament, as a transitional stage towards edemocracy, is made with respect to the parliaments or chambers of the Czech Republic, India, Kenya and South Africa The outcome of this analysis has ... system has an ability to self-organise and regenerate itself on a continuous basis 7.4 Senge’s learning organisation A shift from e-parliament to e-democracy would necessitate that parliaments adapt ... history of American democracy, there was a time when a message could travel only as fast as a horse could gallop or a ship could sail Today, a message from the American people to their representatives...

Ngày tải lên: 10/05/2014, 16:26