a model for studying production of secondary metabolites

... repartition of information along the time scale For a model f(t,&thetas;), depending on the parameter vector &thetas;, the sensitivity function of a parameter &thetas;is the partial ... central states For Sci 18, 109-120 Corman A, Carret G, Pave A, Flandrois JP, Couix C (1986) Bacterial growth measurement using an auto-mated system: mathematical modelling and analysis of growth ... advantage of these models is that they can provide an efficient summary of the data via a small number of meaningful parameters, the significance of which does not change with the trials Our aim

Ngày tải lên: 08/08/2014, 19:21

... demographic variables and the total score of the BPRS, BSI, and Client Observation Scale General linear model (mixed model analysis of variance (ANOVA)) was used to examine both within and between ... perception of entrapment, but, instead, elicits more semblances of it in a circular manner Patients have reasons to keep such activity private from therapy and are barely aware of it as the source of ... differences was performed for education and marital status using χ2, gender using Fisher's exact test, and age using the t test A correlation matrix was performed to examine for any associations between

Ngày tải lên: 08/08/2014, 23:21

... discrimi- nate between particular individuals in a stand. Sap flow data have been used for estimating hourly transpiration and canopy conductances in a range of forest stands ... [...]... area index values (table I), assuming the needles had a semi-cylindrical shape, and calculating the sap flux as the average of the measurements made at a height of ... summarises the sampling procedure applied for each variable measured. 3.2. Azimuthal variability of sap flux density Azimuthal variations in sap flux density across the sapwood

Ngày tải lên: 09/08/2014, 04:20

... 100 Large set of transporters Reduced set of transporters (a) Chlamydophila pneumoniae Chlamydophila abortus 0.2 Nosema ceranae Nosema ceranae Nosema ceranae Nosema ceranae Antonospora locustae ... sequence coverage of the large genome of the microsporidian Octosporea bayeri O bayeri is a parasite of the freshwater planktonic crusteacean Daph-nia magna [39] Other DaphDaph-nia species have never ... uncultivatable organisms from which only a handful of contaminant-free DNA can be extracted Finally, an important goal of the present study was to gather a large amount of genome sequence information

Ngày tải lên: 09/08/2014, 20:20

... dehy-drogenase (GAPDH) (forward 5'AGAACGGGAAGCTTGTCATC; reverse 5'TGC-TGAT-GATCTTGAGGCTG) spanning an amplicon of 247 bp were always run in parallel for reasons of control RT-PCR products of caspase-3 were ... TUNEL label-ling assay, to further validate the importance of cleaved caspase-3 as a relevant biomarker for apoptosis In an ideal setup these data would have been correlated to actual patient ... in activated cells of S phase was also included as test of more functional relevance An important key regulator of the apoptotic pathway such as caspase-3 was also evaluated immunohistologically

Ngày tải lên: 12/08/2014, 15:20

... pneumococcal polysaccharide vaccine (64% [21]) was seen as the absolute maximum attainable vaccine coverage rate for the vaccine against HZ Thus, the selected rate of 40% was perceived to be an attainable ... 50 years and more Additional material Additional file Vaccination Characteristics Supplemental data Additional file Calculation of Utilities Supplemental data Competing interests VR and MB are ... bands, the analysis of a single age group resulted in nearly identical ICERs as that of the 5-year age group it falls within For example, if a vaccination strategy was applied to those Page of

Ngày tải lên: 13/08/2014, 11:22

... population The fre-quencies of alleles A and a are q and 1 - q, respectively For a particular genotype j of this QTL (j = 0 for aa, 1 for Aa and 2 for AA), the parameters describing circadian rhythms ... two alleles A and a for circadian rhythms on the basis of non-random association The allele frequencies are assumed to be p = 0.6 for allele M and q = 0.6 for allele A A positive value of linkage ... properties of the model Model Mathematical Modeling of Circadian Rhythms In all organisms studied so far, circadian rhythms that allow adaptation to a periodically changing environment originate from

Ngày tải lên: 13/08/2014, 16:21

... Taking for granted the accuracy of the paradigm of the pathogenetic role of vascular deprivation and anoxia in bringing about necrosis of the femoral head, revasculari-zation and oxygenation ought ... an exaggerated revascularization of the formerly avascular femoral heads To conclude, the above alterations are unmistakably exclusive to the healing phase of osteonecrosis of the femoral head ... reparative activities that are conventionally accepted as the epitome of revitalization of avascular dead bone Investigators have a priori endeavored to enable vascular ingrowth Accepting that

Ngày tải lên: 13/08/2014, 23:20

... Veleva and Ellenbecker [65], a good indicator should satisfy one or more of the following qualities: Trang 38 Based on available and accurate data  Verifiable  Based on a set of indicators rather ... In Canada, EPR is implemented through a variety of approaches Although there is no EPR law at the national-level, nearly all the provinces and territories in Canada have their own programs and ... developing countries in Asia such as Thailand, Malaysia, Vietnam and Indonesia are also considering the adoption of EPR laws With the National Waste Policy (2009) in Australia, its government is

Ngày tải lên: 09/09/2015, 11:16

... conditions: Model boundary conditions are upstream discharge at Dau Tieng, Tri An, Phuoc Hoa dams and sea level at Vung Tau Rainfall data is at Tan Son Nhat (airport) station Model is calibrated against ... Improvement of main drainage canal of THLG; - Installation of new pipes to increase drainage discharge (3) Topographical data There are available canal cross-sections, location map and dimension of pipes ... branches of lower Dong Nai river 11 Climate: Annual temperature and humidity are high There are two seasons of the year: wet and dry Average annual rainfall is 1915 mm and rainfall amount in wet season

Ngày tải lên: 17/01/2020, 16:43

... post-hoc analysis with the availabil-ity of all clinical data such as vital signs, infectiological, laboratory and radiological data This final analysis was performed after discharge of the patient ... represented a linear combination of variables already present in the dataset Statistical analyses Methodological concept Machine learning is a branch of artificial intelligence used for data analysis ... External validation of our model in an un-related dataset is necessary to confirm the generalizability of the proposed approach across populations and treat-ment standards Additional file Additional

Ngày tải lên: 20/02/2020, 21:59

... general, is an analysis on layers that contains spatial data to evaluate and select particular area based on its suitability criteria classified according to certain measures and processes (Malczewski, ... the location information centre for seaweed cultivation, whereas for fuzzy AHP based spatial analysis, 4.592 Ha area is the most suitable area for information centre for seaweed cultivation in ... selection of suitable location for the information centre for seaweed farming in Southeast Maluku district, Indonesia Analytical hierarchy process (AHP), in classical and fuzzy forms, was an approach

Ngày tải lên: 26/05/2020, 22:30

... Trang 1R E S E A R C H A R T I C L E Open Accessstudying the role of the transportome in pancreatic cancer Doaa Tawfik1, Angela Zaccagnino1, Alexander Bernt1, Monika Szczepanowski2, Wolfram Klapper3, ... Earlier, mucin− 1, a marker of the apical border of the normal pancreatic epithelial cells, and β-catenin a basolateral marker were utilized to stain HS and ML cells It was shown that HS regained ... via detec-tion of protein levels of respective markers and bioinformatic analyses of the data from the two arrays Known epithelial marker like E-cadherin (CDH1) and alpha catenin (CTNNA1) and

Ngày tải lên: 17/06/2020, 11:40

... (excellent) Trang 5Data collection and analysisAn anonymized database was used to collect all informa-tion related to the AMA-AC program This database was secured and managed by an external service ... AMA-AC (Ambulatory Medical Assistance - After Cancer) model, a variant of the shared care model which is based on close collaborations between a NC and the patient’s GP for the surveillance of ... specialists, planning appointments, and addressing all relevant information Data collected by the AMA-AC program Initial patient characteristics Individual, disease-related and treatment-related

Ngày tải lên: 23/09/2020, 00:12

... level was 5% The analysis was repeated removing the least significant covariate in order to use all available data, in particular the molecular markers were only done for a subset of patients Model ... It can also be seen that a change in several variables at the same time can have a major negative impact on the survival probability for the individual patient, while a change in only one of the ... Stockhausen1, Helle Broholm3, Michael Kosteljanetz4 and Hans Skovgaard Poulsen1* Abstract Background: Although implementation of temozolomide (TMZ) as a part of primary therapy for glioblastoma multiforme

Ngày tải lên: 05/11/2020, 06:04

... variability which can be accounted for by the arraysτ2 kand an the remaining variabilityσ2 REIDS Scores for Quantification of Alternative Splicing The advantage of a mixed model formulation for ... Human Exon 1.0 ST array and contains 10 paired tumor-normal cancer samples The data was ana-lyzed before [9, 26] and is publicly available on the Affymetrix website The HTA data The Human Transcriptome ... by applying a factor analysis model to calculate a score of informativeness based on signal to noise ratio [32] We used a mixed model framework for Informative/Non-Informative calls (I/NI calls)

Ngày tải lên: 25/11/2020, 17:48

... ages of 3 to 5, expressive language delay is a concern that parents commonly cite as taking the developmental evaluation Preschool language problems have a significant association with language ... the fact that both teachers and parents are trained, it is necessary to build the indices and indicators based on a transparent reconceptualization of expressive language Based on the elaboration ... size; lack of resources and professional support for teachers; teachers are not trained and prepared for the inclusive teaching strategies All learners come to school with a particular cultural heritage

Ngày tải lên: 27/01/2021, 04:38

... http://scholar.sun.ac.za democracy, can help parliaments to become more transparent, accessible, accountable and effective in promoting democracy e-Parliament enables automation of parliamentary information ... many parliaments lack a strategic plan, an adequate ICT infrastructure, basic tools for Members of Parliament and staff, systems for managing documents and trained ICT staff The status of the ... virtual forums for debate, can provide a platform for freedom of speech and a channel through which representatives can be contacted, engaged with and influenced As yet this form of e-democracy has...

Ngày tải lên: 10/05/2014, 16:26

... S., Gautam, A. , Sahrma, A. , Batra, A. , 2010 Centella asiatica (L.): a plant with immense medicinal potential but threatened International Journal of Pharmaceutical Sciences Review and Research ... compounds of asiaticoside and asiatic acid (Sigma Aldrich, St Louis, Missouri, USA) and are in agreement with published data (Mauri and Pietta, 2000; Rafamantanana et al., 2009) The concentrations of ... and light quality on the accumulation of pharmaceutically relevant secondary metabolites, particularly saponins and lignans, using Centella asiatica and Hydrocotyle leucocephala as examples Experiments...

Ngày tải lên: 19/11/2015, 16:47

... performance database was designed to store the majority of the data collected by the LTPP program for easy and convenient dissemination and use The pavement performance database is a relational database ... the subgrade Among these material properties, those associated with asphalt concrete and subgrades are known to fluctuate seasonally Therefore seasonal evaluation of pavement material properties ... Strategic Highway Research Program (SHRP) through United States and Canadian pavement data base (DataPave online version release-18, 2004;http://www.datapave.com) Secondly, statistical and probabilistic...

Ngày tải lên: 04/07/2016, 17:20