a minimally invasive technique for tongue base stabilization

Báo cáo y học: "Is there an optimal minimally invasive technique for left anterior descending coronary artery bypas" pdf

Báo cáo y học: "Is there an optimal minimally invasive technique for left anterior descending coronary artery bypas" pdf

... was 438 years Data was accessed and analysed with statistical software Categorial variables are expressed as number and percentage of patients and were analysed with the Fischer exact test or ... TECAB patients, related to an anastomosis dysfunction as demonstrated by angiography In the PA-CABG group, only two patients had a postoperative angiography control; in both cases, graft and anastomosis ... patients with (%); PA-CABG, Port-Access coronary artery bypass grafting; MIDCAB, minimally invasive direct coronary artery bypass grafting; TECAB, totally endoscopic coronary artery bypass grafting;...

Ngày tải lên: 10/08/2014, 09:21

6 483 0
báo cáo khoa học: " Epiglottis reshaping using CO2 laser: a minimally invasive technique and its potent applications" doc

báo cáo khoa học: " Epiglottis reshaping using CO2 laser: a minimally invasive technique and its potent applications" doc

... native cartilage tissue relies on rapid photothermal heating to accelerate stress relaxation of cartilage grafts [1] Laser mediated cartilage reshaping (thermochondroplasty) is a non-ablative, ... composite cartilage grafts Am J Otolaryngol 1993, 14:410-2 Velegrakis GA, Papadakis CE, Nikolidakis AA, Prokopakis EP, Volitakis ME, Naoumidi I, Helidonis ES: In vitro ear cartilage shaping with carbon ... Jackson C, Jackson CL: Diseases and Injuries of the Larynx Macmillan, New York; 1942:63-68 Venkatakarthikeyan C, Thakar Alok, Lodha Rakesh: Endoscopic correction of severe laryngomalacia Indian...

Ngày tải lên: 11/08/2014, 20:20

4 300 0
báo cáo hóa học:" Comparison of a minimally invasive posterior approach and the standard posterior approach for total hip arthroplasty A prospective and comparative study" doc

báo cáo hóa học:" Comparison of a minimally invasive posterior approach and the standard posterior approach for total hip arthroplasty A prospective and comparative study" doc

... intubation anesthesia A Cell Saver was used in all cases intraoperatively and to remove blood from the operated area via Redon drainage tubes (14 Charrier intra-articular and 12 Charrier subcutaneous) ... surgical approach and the radiological assessments blinded for the two assessing authors (A. M and M.S.) Reliability for the radiographic examinations was high, with an intra-assessor, intra-class ... one accepts that the muscle enzyme values are meaningful parameters, then this could mean on one hand that the degree of trauma associated with minimally invasive and standard posterior approaches...

Ngày tải lên: 20/06/2014, 04:20

7 436 0
báo cáo hóa học:" In vivo evaluation of a vibration analysis technique for the per-operative monitoring of the fixation of hip prostheses" pdf

báo cáo hóa học:" In vivo evaluation of a vibration analysis technique for the per-operative monitoring of the fixation of hip prostheses" pdf

... for the mechanical characterization of the primary bone-prosthesis stability In a previous study we demonstrated the feasibility and validity of a vibration analysis technique for the assessment ... stages and canal and reinserting the prosthesis The FRF had a normal evolution during the reinsertion and the graphs corresponding to the final two stages, labelled as stage 4a and stage 5a, are ... been avoided in the case of an abnormal bone structure and a deformed endomedullary canal as the FRF analysis showed an abnormality and the surgeon was alerted to the situation in time during insertion...

Ngày tải lên: 20/06/2014, 01:20

10 544 0
Báo cáo hóa học: " A Robust Parametric Technique for Multipath Channel Estimation in the Uplink of a DS-CDMA System" pot

Báo cáo hóa học: " A Robust Parametric Technique for Multipath Channel Estimation in the Uplink of a DS-CDMA System" pot

... Problems, o chapter 9, SIAM, Philadelphia, Pa, USA, 1996 [20] A A Rontogiannis, A Marava, K Berberidis, and J Palicot, “Efficient multipath channel estimation using a semiblind parametric technique, ” ... 1990, he was a Research Assistant at the Research Adademic Computer Technology Institute (RACTI), Patras, Greece, and a Teaching Assistant at the Computer Engineering and Informatics Department ... oversampling factor Q increase As a result, ma(i,i) − trix [Rη ]−1 and accordingly matrix Rη tend to a diagonal − matrix with equal diagonal elements In practice, matrix Rη possesses a “heavy” main...

Ngày tải lên: 22/06/2014, 22:20

12 439 0
A Reverse Engineering Technique for Creating Virtual Robots potx

A Reverse Engineering Technique for Creating Virtual Robots potx

... system for digitalization was set on a stiff and stabile portable frame, which enables high quality acquisition of snaps Before shooting, the system was calibrated with a special calibration tablet ... transformation matrix is a product of four simple transformation matrices to Eq (1) holds for rotational joints where θi is the joint variable We put the parameters for the DH notation, for all ... T06 = A1 ⋅ A2 ⋅ A3 ⋅ A4 ⋅ A5 ⋅ A6 = [ a1 a2 a3 a4 ] (10) The elements of the matrix are a1 , a2 , a3 , a4 and they are given in Eqs (11) to (14) The Eq (10) is a solution of the direct kinematic...

Ngày tải lên: 02/08/2014, 09:21

9 358 0
Báo cáo khoa học: " Development of a neuro-fuzzy technique for automated parameter optimization of inverse treatment planning" doc

Báo cáo khoa học: " Development of a neuro-fuzzy technique for automated parameter optimization of inverse treatment planning" doc

... ANFIS and (b) human plan Prostate plan evaluation for (a) ANFIS and (b) human plan The DVHs are shown in (c) ANFIS is displayed as solid lines, plans created by human as dot lines and FIS as dashed ... readout and stored in a data base To generate useable data files for the NFIDENT application we used a MATLAB routine to calculate e.g the relative differences between the constraints and calculated ... Human ANFIS 40 30 Human 20 FIS 10 ANFIS 0 10 20 30 40 50 60 70 80 90 100 110 (c) Figure Brain plan evaluation for (a) ANFIS and (b) human plan Brain plan evaluation for (a) ANFIS and (b) human...

Ngày tải lên: 09/08/2014, 10:20

16 511 0
Báo cáo y học: "Immunohistological assessment of the synovial tissue in small joints in rheumatoid arthritis: validation of a minimally invasive ultrasound-guided synovial biopsy procedure" potx

Báo cáo y học: "Immunohistological assessment of the synovial tissue in small joints in rheumatoid arthritis: validation of a minimally invasive ultrasound-guided synovial biopsy procedure" potx

... marker A separate binary mask was created that identified the total tissue area in each image, so the final parameter of analysis was the area fraction To speed up the image analysis process, all ... procedures were performed using an ad hoc macro program for each marker Statistical analysis The area fraction of immunoreactivity for each marker was measured on multiple HPFs for each patient The interfield ... of a second metacarpophalangeal joint the portal portal and technique Ultrasound-guided synovial biopsy of a second metacarpophalangeal joint using using the and forcepsforceps technique Arrow,...

Ngày tải lên: 09/08/2014, 10:21

9 430 0
Báo cáo y học: " A double shunt technique for the prevention of ischaemia of a congenital, solitary, pelvic kidn" pps

Báo cáo y học: " A double shunt technique for the prevention of ischaemia of a congenital, solitary, pelvic kidn" pps

... disastrous renal infarction and subsequent functional impairment Murakami et al also reported a 77-year-old patient with an AAA associated with a CSPK, which was supplied by two aberrant renal arteries ... Endovascular repair of abdominal aortic aneurysms in patients with congenital renal vascular anomalies J Vasc Surg 1999, 30:407-15 Murakami T, Makino Y, Suto Y, Yasuda K: Abdominal aortic aneurysm ... AAA Kaplan et al first presented a patient with a single renal artery arising from the right common iliac artery [7] The AAA was successfully repaired endoluminally with a tube stent graft, and...

Ngày tải lên: 11/08/2014, 00:22

4 313 0
Báo cáo y học: "Endoscopic Facet Debridement for the treatment of facet arthritic pain – a novel new technique

Báo cáo y học: "Endoscopic Facet Debridement for the treatment of facet arthritic pain – a novel new technique

... were diagnosed with facet pain Primary outcome measure was percent change in facet-related pain as measured by Visual Analog Scale (VAS) score at final follow-up visit Secondary outcome was change ... investigate the long-term efficacy of facet debridement for the treatment of chronic back pain originating in the facet joint MATERIALS AND METHODS Patient enrollment and evaluation All patients treated ... comparable to the more commonly used RFA, with results durable for at least years Larger scale trials with a control group are warranted to further evaluate the relative efficacy of this surgical...

Ngày tải lên: 26/10/2012, 09:32

4 600 0
A Technique for Practising Conditional Sentence1

A Technique for Practising Conditional Sentence1

... stories All types of conditionals can be practiced at the same time It is essential, however, that learners know the difference in meaning and usage of various types of conditionals Short Narrations ... wouldn't have had so much to drink If I hadn't had so much to drink, I wouldn't have started a fight If I hadn't started a fight, I wouldn't have been taken to the police station If I hadn't been arrested ... is another variation of the whole class activity Divide the class into two equal groups Ask the first group to write only 'if clauses', and the second group only 'major clauses' Allocate a student-assessor...

Ngày tải lên: 06/09/2013, 11:10

2 286 0
Báo cáo khoa học: "A Unified Single Scan Algorithm for Japanese Base Phrase Chunking and Dependency Parsing" pdf

Báo cáo khoa học: "A Unified Single Scan Algorithm for Japanese Base Phrase Chunking and Dependency Parsing" pdf

... 2000, pages 558–564 S Mori 2002 A stochastic parser based on an SLM with arboreal context trees In Proc of COLING 2002 S Sekine, K Uchimoto, and H Isahara 2000 Backward beam search algorithm for ... Learning, pages 255–268 MIT Press T Kudo and Y Matsumoto 2002 Japanese dependency analysis using cascaded chunking In Proc of CoNLL2002, pages 63–69 S Kurohashi and M Nagao 1998 Building a Japanese ... examined 0, 1, and for n Features We have designed rather simple features based on the common feature set (Uchimoto et al., 1999; Kudo and Matsumoto, 2002; Sassano, 2004) for bunsetsu-based parsers We...

Ngày tải lên: 17/03/2014, 02:20

4 287 0
A study on technique to improve speaking skill for secondary student in Quang Ninh.

A study on technique to improve speaking skill for secondary student in Quang Ninh.

... Joanna B, Westrup H (2003: 12) Many teachers worldwide have to teach mainly grammar and vocabulary because these areas are tested in examinations This means that speaking is a neglected language ... information for their speaking activities It may be a paragraph, a magazine, a report, and a book…this show that, reading supports speaking by providing necessary information Students must have ... orphanage Mar 26 am – pm Central stadium Have big gathering to Apr 15 support cultural – sport pm – pm programs 34 CHAPTER 2: DATA COLECTIONS AND ANALYSIS This chapter aims at showing the attitudes...

Ngày tải lên: 19/03/2014, 17:07

73 1,7K 15
Novel technique for rapid detection of a-globin gene mutations and deletions pot

Novel technique for rapid detection of a-globin gene mutations and deletions pot

... — peak peaks peak — aa/aa CS/aa QS/aa WS/aa of mutation carrier samples, as follows: cases of aCSa/ aa, cases of aQSa/aa, and cases of aWSa/aa (Table I) These results were in accordance with ... /QS cases, and /WS cases) 2a3 .7/aa 2a4 .2/aa 2a3 .7/ -a4 .2 2a3 .7/- 2a4 .2/- 2a3 .7/ -a3 .7 2a4 .2/ -a4 .2 /-aa/aa (including CS/aa cases, QS/aa cases, and WS/aa cases) the original genotype The method has ... for the duplex PCR products of DNA samples of known genotypes at 50 C SEA/ SEA; SEA/aa; -SEA/aCSa; aa/aa; 5 23.7/aa; 24.2/aa; aQSaa/ aa The peak appeared at 5.1 0.1 min, which indicates aa,...

Ngày tải lên: 23/03/2014, 22:20

8 559 0
Báo cáo khoa học: "A Figure of Merit Technique for the Resolution of Non-Grammatical Ambiguity" ppt

Báo cáo khoa học: "A Figure of Merit Technique for the Resolution of Non-Grammatical Ambiguity" ppt

... Collection and Organization of Data on Word Occurrences In order to assign relative probability measures to a fairly large number of target equivalents, a statistical analysis was performed manually ... depends upon the availability of the probability measures of target equivalents, only those target equivalents for which such information is available from the data are used in the calculations described ... collecting the data from a much larger sample than the one that was used in the above calculations Such a RESOLUTION OF NON-GRAMMATICAL AMBIGUITY collection of data could be done by means of a computer...

Ngày tải lên: 30/03/2014, 17:20

5 300 0
báo cáo hóa học:" A highly invasive human glioblastoma pre-clinical model for testing therapeutics" pot

báo cáo hóa học:" A highly invasive human glioblastoma pre-clinical model for testing therapeutics" pot

... Acknowledgements We are grateful to Drs David Wenkert and Yuehai Shen for 17AAG characterization and to Drs Jacob Zhang and Kyle Furge for statistical analysis We thank Michelle Bassett for assistance in ... test was used for comparison of 17AAG treatments against DBM2 pulmonary metastases Results GBM tumor cells have metastatic potential Primary and metastatic brain tumors are often aggressive and ... recorded Statistical analysis Statistical analysis of 17AAG-treated DBM2 intracranial tumor growth was performed with a student's "t" test Log-rank test was used to analyze survival time Chisquare test...

Ngày tải lên: 18/06/2014, 15:20

13 413 0
Báo cáo hóa học: "Exhaustive expansion: A novel technique for analyzing complex data generated by higherorder polychromatic flow cytometry experiments" pot

Báo cáo hóa học: "Exhaustive expansion: A novel technique for analyzing complex data generated by higherorder polychromatic flow cytometry experiments" pot

... 18 Tateishi-Yuyama E, Matsubara H, Murohara T, Ikeda U, Shintani S, Masaki H, Amano K, Kishimoto Y, Yoshimoto K, Akashi H, Shimada K, Iwasaka T, Imaizumi T: Therapeutic angiogenesis for patients ... extension to n-ary classification systems (e.g dim, intermediate, bright) is possible After derivation of frequencies for all sets, data was loaded into a relational database (MySQL) and analyzed with ... data analysis as suggested by the data itself and the underlying science For example, while we used a statistical test to quantify peaks in the melanoma study, we could have defined peaks based...

Ngày tải lên: 18/06/2014, 16:20

15 476 0
Báo cáo sinh học: " CODEHOP-mediated PCR – A powerful technique for the identification and characterization of viral genomes" pptx

Báo cáo sinh học: " CODEHOP-mediated PCR – A powerful technique for the identification and characterization of viral genomes" pptx

... GTGGTCGATTTTGCCAGCCTGTACCCGAGCATCATCCAGGCGCACAACCTGTGC GTAGTAGACTTTGCTAGCCTGTATCCTAGTATTATACAAGCTCATAATCTATGC GTGGTGGACTTTGCCAGCCTGTACCCCACCATCATCCAGGCCCACAACCTCTGC GTAGTGGACTTTGCCAGCCTGTACCCAAGCATTATTCAGGCACACAATCTGTGT GTAGTTGACTTTGCCAGCTTGTACCCCAGCATCATCCAGGCTCATAATCTATGC ... (151aa) CAB61754 (151aa) AAC55648 (55aa) AAD30141 (56aa) AAG23218 (158aa) AAC57974 (151aa) DFASA-GDTD1B AAF23082 (158aa) DFASA-GDTD1B DFASA-GDTD1B DFASA-GDTD1B DFASA-GDTD1B DFASA-GDTD1B DFASA-GDTD1B ... GTTTTTGATTTCCAAAGTTTGTATCCAAGTATTATGATGGCTCATAATCTGTGT RhCMV GTGTTTGACTTTGCCAGCCTGTATCCGTCAATTATCATGGCACATAATCTCTGT RFHVMm GTTGTGGATTTTGCTAGCCTTTATCCCAGCATCATGCAGGCCCACAACCTATGT γ AtHV3 GTAGTAGACTTTGCTAGCCTTTACCCAAGTATTATACAAGCTCATAATCTGTGT...

Ngày tải lên: 18/06/2014, 22:20

24 605 0
w