... with the recombinant allergen after affinity purification using the mAb IG12 [18] The natural allergen Phl p was also found to be capable of degrading a synthetic substrate at a papaincleavage site ... yeast Pichia pastoris, catalyzed the degradation of a synthetic substrate containing a papain-cleavage site, as well as other proteins Moreover, a protein with strong proteolytic activity was ... supernatant containing rPhl p N showed strong degradation of the full-length allergen and accumulation of a truncated 15-kDa fragment at about pH 4.5 (Fig 3A) This sharp band lacked the N-terminal...
Ngày tải lên: 08/03/2014, 22:20
... governance In the area of micro-finance, the World Bank played a major role in the establishment of the Consultative Group to Assist the Poorest (CGAP) A consortium of 29 bilateral and multilateral ... investment climates (1992-94) Annual percentage point reduction in headcount poverty Uttar Pradesh West Bengal Kerala Punjab Tamil Nadu Karnataka Poor Andra Pradesh Gujarat Maharashtra Good State investment ... is sound or at least moving in the right 56 World Bank (200 1a) World Bank (200 1a) 58 The World Bank has developed a number of databases of indices, namely: The World Bank s World Business Environment...
Ngày tải lên: 16/02/2014, 06:20
RESPONSIBLE REFORM OF THE WORLD BANK - THE ROLE OF THE UNITED STATES IN IMPROVING THE DEVELOPMENT EFFECTIVENESS OF WORLD BANK OPERATIONS pptx
... structural adjustment Structural and sectoral adjustment loans make up an increasingly large percentage of the Bank s lending portfolio, and they have profound social and environmental impacts The Bank ... influence the way that the World Bank operates around the world A broad array of civil society organizations, including development groups, people of faith, labor, environmental organizations, and ... indicators as a result of the loan or grant, and mandatory public reporting of these indicators 12 THE WORLD BANK AND WORKERS’ RIGHTS American Federation of Labor and Congress of Industrial Organizations...
Ngày tải lên: 29/03/2014, 08:20
Báo cáo Y học: Characterization of a Saccharomyces cerevisiae NADP(H)-dependent alcohol dehydrogenase (ADHVII), a member of the cinnamyl alcohol dehydrogenase family pptx
... the genomic DNA from the S cerevisiae S288C strain using the oligonucleotides 5¢GGCGAGCTCAAAATGCTTTACCCAGAAAAATT TGAGG-3¢ and 5¢GGCTCTAGACTATTTATGGAA TTTCTTATC-3¢ that introduced SacI and XbaI ... although the kcat and Km values with ADHVII are approximately half the values found for ADHVI The catalytic efficiencies towards the oxidation of cinnamyl alcohol and several aliphatic alcohols are ... activity Cinnamaldehyde Phenylacetaldehyde Benzaldehyde Coniferaldehyde Veratraldehyde Anisaldehyde Vanillin Propanal Butanal Pentanal Hexanal Heptanal Octanal 2-Methylpropanal 2-Methylbutanal 3-Methylbutanal...
Ngày tải lên: 31/03/2014, 08:20
the world bank group ict for greater development impact information communication technology
... MIGA MIS mLab NGO OAS OECD OGP P4R African Development Bank Advancement through Interactive Radio Asia-Pacific Economic Cooperation Association of Southeast Asian Nations Automatic Teller Machine ... publicly available online to increase accountability Aid and budgetary data standards—such as the International Aid Transparency Initiative, subscribed to by 21 major aid donors—enables data-driven ... energy-efficient shared infrastructure for data storing and processing 25 The World Bank Group s strategic focus 94 WBG comparative advantages The World Bank, International Finance Corporation (IFC), and Multilateral...
Ngày tải lên: 23/07/2014, 15:27
Báo cáo y học: "Development of mental health first aid guidelines on how a member of the public can support a person affected by a traumatic event: a Delphi study" doc
... to the child that they cannot keep The first aider should ensure that that they or another adult are available to take care of the child The first aider should tell the child that they or another ... with the traumatised person The first aider should speak clearly and avoid clinical and technical language The first aider should communicate with the person as an equal, rather than as a superior ... that are available (for example, crisis lines and health centres) The first aider should be aware that the person may not remember all the details of the event The first aider should be aware...
Ngày tải lên: 11/08/2014, 16:22
the subsidy regulations and vietnam’s position as a member of the wto
... classed as financial contributions even though they are not within the strict meaning of the term.21 In a debate of Canada over two dispute cases, Canada – Dairy and Canada – Aircraft it was ... ska visas här Agricultural subsidies are mainly governed by the AoA though the SCM is also applied in some cases That means the AoA and the SCM may even be in conflict The AoA may legally allow ... in Agriculture, 2003, P160-165 22 The Canada – Dairy, report of the Panel, supra n 19, para 4.310 and Canada – Aircraff, report of the Panel, supra n 36, para 5.27 18 Fel! Använd fliken Start...
Ngày tải lên: 18/08/2014, 12:35
The World Bank Group’s Response to the Global Economic Crisisch03
... with 27 banks in Europe and Central Asia, the Middle East and North Africa, Latin America and the Caribbean, and Africa Source: IEG • 36 | Latin America and the Caribbean: The Multilateral Crisis ... Pakistan, Tanzania, and Vietnam—with DPOs also to a number of other countries in Sub-Saharan Africa (Burkina Faso, Côte d’Ivoire, Ghana, Mozambique, and Rwanda, among them) and South Asia (Afghanistan, ... borrowers As the scale of the demand became apparent, the Bank took measures to ration available IBRD capital and get Board approval for an IDA Fast-Track Facility, while IFC began to develop global crisis...
Ngày tải lên: 30/08/2016, 15:38
Galbraith inequality and instability; a study of the world economy just before the great crisis (2012)
... 1; EAP = East Asia and Pacific; ECA = Eastern Europe and Central Asia; LAC = Latin America; MENA = Middle East and North Africa; NA = North America; SAS = South Asia; SSA = sub-Saharan Africa; ... Theil statistic Thus readily available archives available from practically any country and many multinational agencies can be mined to generate a large archive of inequality measures, each of which ... China are highly problematic And since China is about a quarter of the world s population, mismeasurement of average income in China can have a significant effect on the measure of global inequality...
Ngày tải lên: 29/03/2018, 14:21
Báo cáo khoa học: Identification of a copper-repressible C-type heme protein of Methylococcus capsulatus (Bath) A member of a novel group of the bacterial di-heme cytochrome c peroxidase family of proteins docx
... processing would lead to a mature protein of 732 amino acids with a theoretical molecular mass of 78 kDa A search in the PROSITE database of protein families and domains [12] with MCA2590 revealed two ... located on the surface of the bacterium and is noncovalently attached to the outer membrane The extracellular localization is in accordance with the prediction of a signal peptide in a primary ... RT-PCR analyses revealed that this regulation takes place at the transcriptional level The concomitant regulation of SACCP and MopE is also in accordance with the possibility that the MCA2590 and...
Ngày tải lên: 23/03/2014, 11:20
The World Bank’s Genuine Savings Indicator: a Useful Measure of Sustainability? pptx
... depreciation of human made capital and depreciation of natural capital there But how is depreciation of natural capital caused by the Japanese economy around the world counted? See also: The Environment ... of natural capital which produce magic numbers Thus the economy of Japan appears at the top of the league in tables on weak sustainability because savings are very high and more than compensate ... within a framework that finance and development planning ministries can understand”.8 The genuine savings approach has the advantage over many other types of national environmental accounting that...
Ngày tải lên: 29/03/2014, 09:20
SOME ECONOMIC CONSEQUENCES OF GLOBAL AGING: A Discussion Note for the World Bank doc
... working age person The share of health PaCa Ly Taking the time derivative of the log of this ratio, we find that the rate of change in this share equals the rate of change of P L , which is the rate ... demographic change to facilitate the work of World Bank staff and other interested parties in the area of Population Aging The note describes the importance of population aging world- wide, clarifying ... in whether the prevalence of ADLs and IADLs is rising or falling over time, after standardizing for the aging of the If health care costs per enrollee of a given age rise at the same rate as productivity,...
Ngày tải lên: 31/03/2014, 07:20
Tài liệu Bank Credit - A Study of the Principles and Factors Underlying Advances Made by Banks to Borrowers docx
... form of an overdraft The Bank Acceptance as Bank Credit The bank acceptance, which is a draft or bill drawn upon and accepted by a bank, differs from a loan in the fact that the accepting bank makes ... between bank loans and the loans of a money-lender will be gained if we examine the balance sheet of a bank as the institution expands on the basis of the cash paid in by the shareholders in exchange ... metropolitan banks, and a deposit balance created The primary reasons for the maintenance of balances on de- THE NATURE OF COMMERCIAL BANKING 15 posit with banks in centers to which the locality of a...
Ngày tải lên: 15/02/2014, 01:20
Tài liệu BANKING ON OPPORTUNITY: A SCAN OF THE EVOLVING FIELD OF BANK ON INITIATIVES docx
... from McCann Worldgroup, a large marketing firm that created all of the program’s marketing materials The city then made these materials available to other Bank On initiatives To date, 28 Bank On ... Opportunity A Scan of the Evolving Field of Bank On Initiatives US DEPARTMENT OF THE TREASURY Office of Financial Education and Financial Access BANKING ON OPPORTUNITY A Scan of the Evolving Field of Bank ... US DEPARTMENT OF THE TREASURY Office of Financial Education and Financial Access Banking on Opportunity A Scan of the Evolving Field of Bank On Initiatives A Scan of the Evolving Field of Bank...
Ngày tải lên: 16/02/2014, 06:20
Tài liệu Impoverishing a Continent: The World Bank and the IMF in Africa pdf
... in Afghanistan, Angola, Nicaragua, Panama, and Grenada, and against liberation movements in El Salvador, Guatemala, and the Philippines One observer has called the World Bank- IMF debt management ... overview of the World Bank, the IMF and structural adjustment The World Bank and the IMF THE WORLD BANK or the International Bank for Reconstruction and Development (IBRD) and the International Monetary ... Continent: The World Bank and IMF in Africa 17 for people who have already been made amongst the poorest in the world by the World Bank s SAP Thirty-five percent of Ghanaians lack access to safe water;...
Ngày tải lên: 16/02/2014, 11:20
Tài liệu Báo cáo khoa học: Crystal structure of the catalytic domain of DESC1, a new member of the type II transmembrane serine proteinase family pptx
... that the SEA domain functions by orienting the active site cleft of DESC1 toward plasma and ⁄ or extracellular spaces and away from the cell surface and ⁄ or the extracellular matrix The SEA ... structure of the catalytic domain of DESC1 Scheme Domain organization of human DESC1 membrane region The extracellular part of DESC1 consists of a 120-amino acid SEA domain followed by the C-terminal ... to calculate the Rfree The final R and Rfree values of the model are 0.21 and 0.22 for the complete data ˚ set up to 1.6 A The electron density of the whole main chain of the catalytic domain...
Ngày tải lên: 19/02/2014, 00:20