... Nakamura H, Kano M, Sugimoto C, Mori K, Iida A, Hirata T, Hasegawa M, Yuasa T, Miyazawa M, Takahashi Y, Yasunami M, Kimura A, O ’Connor DH, Watkins DI, Nagai Y: Cytotoxic T lymphocyte-based control ... SIVmac239Gag205E340M as well as SIVmac239, but not in SIVmac239Gag205E CA hexamers Thus, this pocket may be a target candidate for anti-viral drugs Both GagL216S and GagD205E mutations can result ... Protein Data Bank: a redesigned query system and relational database based on the mmCIF schema Nucleic Acids Res 2005, 33:D233-D237. 50 Song H, Nakayama EE, Yokoyama M, Sato H, Levy JA, Shioda T: A
Ngày tải lên: 13/08/2014, 01:20
... significant advantages of functional map-ping is that it can ask and address biologically meaningful questions about the interplay between gene actions and trait dynamics by formulating a series ... , z(T - 1)]for the mRNA change Assume that a putative QTL with alleles A and a affecting circadian rhythms is segregated in the population The fre-quencies of alleles A and a are q and 1 - q, ... Model Mathematical Modeling of Circadian Rhythms In all organisms studied so far, circadian rhythms that allow adaptation to a periodically changing environment originate from negative autoregulation
Ngày tải lên: 13/08/2014, 16:21
HEPATOCYTE GROWTH FACTOR IS a MAJOR CYTOKINE FOR NSC HOMING TO GLIOMA
... endothelial barrier [53] In addition, HMGB1 acts as a pro-inflammatory factor, and is released by damaged cells as a chemoattractant for vascular smooth muscle cells and fibroblasts and induces ... Palumbo et al reported that HMGB1 attract mesoangioblast to migrate across an endothelial monolayer and reach damaged muscle HMGB1 therefore appears to induce stem cell transmigration across an ... migrate towards glioma [29, 30], medulloblastoma [31, 32], and melanoma brain metastases [31] Their unique capability to cross the blood brain barrier provides an additional advantage in treating
Ngày tải lên: 09/09/2015, 08:17
A programmable stimulator for functional electrical stimulation
... Trang 1A PROGRAMMABLE STIMULATOR FOR FUNCTIONAL ELECTRICAL STIMULATION TAN YI JUN JASON NATIONAL UNIVERSITY OF SINGAPORE 2010 Trang 2A PROGRAMMABLE STIMULATOR FOR FUNCTIONAL ELECTRICAL STIMULATION ... layers, 4 metal layers process CIS Continuous Interleave Sampling FES Functional Electrical Stimulation OTA Operational Transconductance Amplifier DAC Digital to Analog Converter ASIC Application ... potential An action potential is an event where the transmembrane potential rises and falls rapidly as shown in Fig 1.8 Action potentials are neural signals responsible for information transfer along
Ngày tải lên: 15/09/2015, 22:43
A potential target for tuberculosis drug discovery
... demonstrated that mpa and pafA mutants are severely attenuated in a mouse model of infection (Darwin et al., 2005) Mpa is an ATPase that forms hexamers like the Clp ATPase Meanwhile, pafA, despite ... adds 11 amino acid tag (AANDENYALAA) to the incomplete protein Proteins tagged with the SsrA peptide are targeted for degradation The C-terminal Ala-Ala residues are critical for SsrA recognition ... Clp ATPase belongs to the AAA+ superfamily of ATPases AAA+ proteins are generally modulated by a group of otherwise unrelated proteins termed adaptor proteins An adaptor protein serves as an accessory
Ngày tải lên: 26/11/2015, 22:38
7 practical ways to turn diversity into a major asset for your company
... Your PlanTrang 23Identifying and Resolving InequitiesTrang 24Equity Pay Self Audits –Pros and Cons Trang 25Manager FavoritismTrang 26A Note on NegotiationStudies show a difference in negotiating ... Who needs to hear about diversity in 2016? Haven’t we “been there/done that” already? Trang 11Defining the IssuesDiversity presents challenges. Bias is human. Bias can be FOR or AGAINST. Diversity ... L&D programs to retain and recruit their employees. Trang 34Immediate Actions Examine your workforce – who works at your organization? What types of diversity do you already celebrate? Where
Ngày tải lên: 30/11/2018, 18:20
Caveolin-1 and MLRs: A potential target for neuronal growth and neuroplasticity after ischemic stroke
... Scientific Rationale for the Inclusion and Exclusion Criteria for Intravenous Alteplase in Acute Ischemic Stroke: A Statement for Healthcare Professionals From the American Heart Association/American ... In addition to the classical non-coding RNAs (ncRNAs), transfer RNA (tRNA) and ribosomal RNA (rRNA), additional families of ncRNAs such as microRNAs (miRNAs), long non-coding RNAs (lncRNAs), ... engorgement, and consolidation Membrane lipid rafts are located at the leading edge of neuronal growth cones, providing an essential plasma membrane platform to establish cellular polarity and to
Ngày tải lên: 15/01/2020, 14:39
Fine-mapping of qGW4.05, a major QTL for kernel weight and size in maize
... association mapping to fine-map and identify candidate gene(s) at qGW4.05, a major quantitative trait locus (QTL) associated with maize kernel weight and size QTL qGW4.05 was fine-mapped to a ... the strategy of regional association mapping to further narrow down qGW4.05 and identify candidate genes An association mapping panel that contains 541 inbreed lines was field evaluated at three ... QTLs qGW4.05 is a major QTL that is associated with kernel weight and size in maize We combined linkage analysis and association mapping to fine-map and identify candidate gene(s) at qGW4.05 Results:
Ngày tải lên: 22/05/2020, 04:14
Up-modulation of PLC-β2 reduces the number and malignancy of triple-negative breast tumor cells with a CD133+ /EpCAM+ phenotype: A promising target for preventing progression of TNBC
... Paola Lanuti2,3, Marco Marchisio2,3, Yasamin Al-Qassab1,4, Federica Vezzali1, Silvano Capitani1,5and Valeria Bertagnolo1* Abstract Background: The malignant potential of triple negative breast ... invasive ductal breast carcinomas Chin Med J (Engl) 2009;122:2763 –9. 8 Aomatsu N, Yashiro M, Kashiwagi S, Takashima T, Ishikawa T, Ohsawa M, Wakasa K, Hirakawa K CD133 is a useful surrogate marker ... anti-CD133, FITC-conjugated anti-EpCAM and allophycocyanin Trang 3(APC)-conjugated anti-CD44 (Becton Dickinson, SanJosé, CA) monoclonal antibodies All samples were analyzed by a FACSCalibur flow cytometer
Ngày tải lên: 06/08/2020, 03:46
A kinome siRNA screen identifies HGS as a potential target for liver cancers with oncogenic mutations in CTNNB1
... GCTTTCAGTTGAGCTGACCA-3’ and CTN NB1 reverse 5’-GCTTTCAGTTGAGCTGACCA-3’ or Axin2 forward 5’- TGTCTTAAAGGTCTTGAGGGTTG AC-3’ and Axin 2 reverse 5’- CAACAGATCATCCCAT CCAACA-3’ Transcriptome analysis After ... HGS for-ward 5’- CTCCTGTTGGAGACAGATTGGG -3’ and H GS reverse 5’- GTGTGGGTTCTTGTCGTTGAC -3’, 18S forward 5’-GTAACCCGTTGAACCCCATT-3’ and 18S reverse 5’-CCATCCAATCGGTAGTAGCG-3’, CTNNB1 forward 5’- ... Lescure6, Elaine Del Nery6, Jacques Camonis6, Franck Perez6, Bruno Ragazzon1,2,3and Christine Perret1,2,3,4 Abstract Background: Aberrant activation of the Wnt/β-catenin pathway is a major and frequent
Ngày tải lên: 21/09/2020, 10:24
Plasmalemmal Vesicle Associated Protein (PLVAP) as a therapeutic target for treatment of hepatocellular carcinoma
... lead-ing cause of cancer death in men and the sixth leadlead-ing cause among women HCC accounts for 85% of primary liver cancer [2] and is endemic in Southeast Asia and Sub-Saharan Africa Although ... Trang 1R E S E A R C H A R T I C L E Open AccessPlasmalemmal Vesicle Associated Protein (PLVAP) as a therapeutic target for treatment of hepatocellular carcinoma Yun-Hsin Wang1, Tsung-Yen ... from MECA32 mAb The procedures for preparation of MECA32 anti-PLVAP Fab-TF recombinant protein (MECA32-Fab-Fab-TF) are detailed in the Additional file 2 The purified MECA32-Fab-TF was analyzed
Ngày tải lên: 30/09/2020, 14:52
Application of biotechnology for functional foods thực phẩm chức năng công nghệ thực phẩm IUH
... from the California Bay Laurel (Umbellularia californica) Conventional canola oil contains no lauric acid, and only about 6% short chain saturated fatty acids This was the first transgenic oilseed ... not anticipated for another two decades (Parveez et al 2000) Trang 11Increased saturated fatty acid content: Because saturated fatty acids confer certain functional properties to food fats and ... other dairy foods, and meats are rich in saturated fatty acids So-called “good fats” are rich in unsaturated fatty acids These fats or oils are usually liquid at room temperature Unsaturation
Ngày tải lên: 25/07/2022, 12:56
hedgehog signaling pathway a novel target for cancer therapy vismodegib a promising therapeutic option in treatment of basal cell carcinomas
... metastatic basal cell carcinoma, or with locally advanced basal cell carcinoma that has recurred following surgery or who are not candidates for surgery or radiation Basal-cell carcinoma is a ... maintenance and repair The inappropriate reactivation and aberrant signaling in adult tissues is associated with the development of several human cancers, mainly basal cell carcinoma (BCC) and ... medulloblastomas, prostate, small cell lung cancers, pancreatic carcinoma and leukemias.[2] Hence, this pathway may represent a potential therapeutic target for new anticancer treatments Drugs that
Ngày tải lên: 02/11/2022, 11:36
implication of dorsostriatal d3 receptors in motivational processes a potential target for neuropsychiatric symptoms in parkinson s disease
... implantations, brain processing for immunohistochem-istry and autoradiographic experiments, as well as data and statistical analyses Animals Experiments were performed on male Sprague Dawley rats ... 0.001, sham vs 6-OHDA (sham, n = 8; 6-OHDA, n = 7) AP: Anteroposterior; DLS: dorsolateral striatum; DMS: dorsomedial striatum; l-mSNc: lateral-medial substantia nigra pars compacta; VTA: ventral tegmental ... sham (n = 8) vs 6-OHDA (n = 7) DLS: dorsolateral striatum; DMS: dorsomedial striatum; NAc: nucleus accumbens (D–F) Photographs of autoradiograms obtained at striatal level for sham and 6-OHDA–
Ngày tải lên: 04/12/2022, 14:49
rna seq of life stages of the oomycete phytophthora infestans reveals dynamic changes in metabolic signal transduction and pathogenesis genes and a major role for calcium signaling in development
... includeamino acid transporters, which belong mostly in theamino acid auxin permease and amino acid-polyamine-organocation groups (AAP and APC; Fig 5a), sugartransporters in the major facilitator, ... mRNA abundance ofcalcium channel genes in spores is the concomitant Fig 3 Comparisons of Illumina RNA-seq and Affymetrix microarray data a Expression level calls of mRNA from sporangia Data are ... was examined on the basis of total CPM, STEkinases showed a strong bias towards sporangia, andcalmodulin-regulated kinases for cleaving sporangia A striking difference between kinases and tases
Ngày tải lên: 04/12/2022, 16:23
Báo cáo khoa học: Alternative splicing: regulation of HIV-1 multiplication as a target for therapeutic action docx
... Trang 1Alternative splicing: regulation of HIV-1 multiplicationas a target for therapeutic action Jamal Tazi1, Nadia Bakkour1, Virginie Marchand2, Lilia Ayadi2, Amina Aboufirassi1and Christiane ... to p300⁄ CBP coactivators J Virol 76, 9724–9734 34 Kuramitsu M, Hashizume C, Yamamoto N, Azuma A, Kamata M, Yamamoto N, Tanaka Y & Aida Y (2005) A novel role for Vpr of human immunodeficiency ... Sci USA 91, 7311–7315 32 Kamata M, Nitahara-Kasahara Y, Miyamoto Y, Yoneda Y & Aida Y (2005) Importin-alpha promotes passage through the nuclear pore complex of human immunodeficiency virus
Ngày tải lên: 06/03/2014, 09:22
Báo cáo khoa học: The human pyridoxal kinase, a plausible target for ginkgotoxin from Ginkgo biloba docx
... treatment for (a) and 60 (b) with alkaline phosphase (Merck, Darmstadt, Germany; 100 U) at 37°C, as analyzed by HPLC Influence of ginkgotoxin on human pyridoxal kinase This material is available as part ... PKH leads inter alia to a decreased availability of PLP for GAD, which catalyses the formation of c-aminobutyric acid, the most potent inhibitory neurotransmitter in the mammalian brain Decreased ... membrane-bound phosphatases (Fig 2A) [13,14] Inside the brain a rephosphorylation to PLP takes place, again catalysed by pyridoxal kinase (Fig 2A) [7,14] As a consequence, there is a requirement for...
Ngày tải lên: 07/03/2014, 10:20
Báo cáo hóa học: "IL-2 as a therapeutic target for the restoration of Foxp3+ regulatory T cell function in organ-specific autoimmunity: implications in pathophysiology and translation to human disease" doc
... type diabetes subjects Immunogenetics 2010, 62:101-107 36 Kawasaki E, Awata T, Ikegami H, Kobayashi T, Maruyama T, Nakanishi K, Shimada A, Uga M, Kurihara S, Kawabata Y, et al: Genetic association ... Cobbold S, Alyanakian MA, Gouarin C, Barriot S, Garcia C, Waldmann H, Bach JF, Chatenoud L: Autoimmune diabetes onset results from qualitative rather than quantitative age-dependent changes in pathogenic ... Health Center, 1650 Cedar Avenue, Montreal, H3G 1A4 , Qc, Canada Full list of author information is available at the end of the article thymic and peripheral CD4+ T cells in humans and mice, and...
Ngày tải lên: 18/06/2014, 16:20
Báo cáo khoa học nông nghiệp " Implementation of the IPM program using weaver ants as a major component for cashew growers in Vietnam " pptx
... plot, and the small black ant, Tapinoma melanocephalum that was abundant on the remaining trees of the plot The Crematogaster ants were nesting on cashew tree branches and the small black ant were ... data clearly show that farmers lack extensive knowledge about the insect pests and diseases and their natural enemies Weaver ant status and farmers’ opinion of them Most orchards had weaver ants, ... of ants Examination of the ant nests the next day showed that almost all the crematogaster ants were dead in their nests, including queen ants, and that the small black ant activity was greatly...
Ngày tải lên: 21/06/2014, 05:20
Card Project VIE: Implementation of the IPM Program Using Weaver Ants as a Major Component for Cashew Growers in Vietnam - MS4" pdf
... South Vietnam Vietnamese Project Team Leader Mr La Pham Lan Australian Organisation Charles Darwin University Australian Personnel Dr Keith Christian and Dr Renkang Peng Date commenced February 2006 ... black ant, Tapinoma melanocephalum, that was abundant on the remaining trees of the plot Baiting of competitive ant species Ant baits (Amdro and Campaign ant bait) brought from Australia were tried ... that almost all the crematogaster ants were dead in their nests, including queen ants, and that the small black ant activity was greatly reduced Seven days later after this baiting, weaver ant...
Ngày tải lên: 21/06/2014, 06:20