a magnetic resonance spectroscopy approach to dyslexia

... examples of linear fractional criteria in Corporate Planning and Bank Balance Sheet Management Fractional objec-tives also occur in other areas of management (for example, in transportation management, ... linear fractional vector optimization problem can be regarded as the image of the solution map of a specific parametric monotone affine variational inequality This paper establishes some facts about ... represented as the image of the solution map of a specific parametric monotone affine variational inequality A similar representation is also valid for the weakly efficient solution set This parametric affine

Ngày tải lên: 06/08/2014, 05:20

... Original article A reduced animal model approach to predicting total additive genetic merit for marker-assisted selection S Saito H Iwaisaki 1 Graduate School of Science and ... Consequently, in equation [8] the vector corresponding to animal i of K can be computed as where Aa p, Aup and Avp are appropriate submatrices of Aa, Au and Av, respec- tively, ... to MAS in animal breeding. Using an animal model (AM) with additive effects for alleles at a marked quantitative trait locus (MQTL) linked to a marker locus (ML) and

Ngày tải lên: 09/08/2014, 18:22

... (Boston, Mass 2004, 21:547-554. 34 Wang F, Luo W: Assessing spatial and nonspatial factors for healthcare access: towards an integrated approach to defining health professional shortage areas Health ... clinics, in addition to the county health department and five area hospitals, serve the majority of the city’s disadvantaged patients and all are part of a large, vertically integrated health-care system ... data and creation of agenda for Community Forum ) Research Team (Coding and analysis of data) Maps / GIS data Figure 3 Flow diagram of data collection and processing plan for community needs assessment.

Ngày tải lên: 10/08/2014, 10:23

... Trang 1Open AccessDatabase SolEST database: a "one-stop shop" approach to the study of Solanaceae transcriptomes Nunzio D'Agostino, Alessandra Traini, Luigi Frusciante and Maria Luisa ... Solanaceae tran-scriptomes and, finally, a valid contribution to compara-tive analysis at molecular level on the Solanaceae family members ESTs are a versatile data source and have multi-ple applications ... successfully aligned only along potato BACs, suggesting that the potato sequencing project, although started later, is providing a complementary contribution to that of tomato Tomato as well as potato BACs

Ngày tải lên: 12/08/2014, 03:21

... sequences are then considered to be potential TFBSs [3-5] This approach, however, does not take into account the combinatorial nature of transcriptional regulation An early attempt to identify CRMs was ... with the TRANSFAC Professional version 8.4 database [52] (Biobase Biological Databases) was used to identify putative transcription factor binding sites within each upstream sequence As a precompiled ... dataset, and vice versa. Comparison to alternative methods We compared our DDM-based method to several methods that claim to be able to find the TFBSs or CRMs responsible Table 1 TFBSs associated

Ngày tải lên: 14/08/2014, 07:21

... 56,646,398 br+ al- AATAGAAGCCAGGCATGGTG 20 48,861,156 48,861,175 ACAACCTGTCCGACCAGAAC 17 56,646,305 56,646,324 M0141F19 ar+ cr+ GGACAGAGGCTTTTGTAGCG 17 56,687,628 56,687,647 ACCACGTAGACAAAGACGGG 20 ... 59,153,765 ar+ cl- GGACAGAGGCTTTTGTAGCG 17 56,687,628 56,687,647 AGAAGAACCCGACGACATTG 20 59,153,849 59,153,868 br+ cr+ TATCCTTCAGGAATCGCCAC 20 53,542,992 53,543,011 ACCACGTAGACAAAGACGGG 20 59,173,964 ... Columbia, Canada V5Z 4S6 † Cancer Research Institute, University of California at San Francisco, San Francisco, California, USA 94143-0808 Correspondence: Marco Marra Email: mmarra@bcgsc.ca © 2007

Ngày tải lên: 14/08/2014, 08:20

... information about the alignments of ESTs to the target genome. human ACAGGTGAGGAGGCG macaque mouse rat ACAGGTGAGAAAG rabbit dog ACAGGTGAGGAGTCG cow ACAGGTGAGCAGTCG armadillo ACAGGTGAGGAG_CA elephant ... character at every position that g does and a DNA base character at every position that g has an... opossum chicken EST ACAGGTGAGGAGGCG ACAGGTGAGAAAG ACAGGTGAGGAGTCG ACAGGTGAGCAGTCG ACAGGTGAGGAG_CA ... classifier accuracy increases as informants are added. The graph shows the generalization accuracy of CONTRAST's start and stop codon classifiers as more informants are added. The x-axis labels

Ngày tải lên: 14/08/2014, 08:20

... parameters. Again, these effects operate on the log mean scale. 2.3. Marginal modeling approach Since there are relatively few observations per animal for estimating the u j , a marginal modeling approach ... calving ease) and purely categorical traits are also encountered. During the 1970s and 1980s, the generalized linear model (GLM 1 ) was developed as a uniform approach to handling all these above ... numerical integration to evaluate the likelihood [4,28], or computer simulation if Markov Chain Monte Carlo methods are used [45]. An alternat- ive approach has been developed that only makes assumptions

Ngày tải lên: 14/08/2014, 13:22

... in a manner that is more acceptable to native speakers of the target language). Our cognitive meta-linguistic approach to teaching L2 learners reading and writing is expected to enhance ... 1987 [35]). Kaplan (1966) [31]’s analysis of the organization of paragraphs in ESL student essays showed that ‘essays written in Oriental languages use an indirect approach and come to the point ... meta-language such as Bialystok (1982) [17], Widdowson (1990) [18], and McCarthy and Carter (1994) [19] who propose an integration of meta-language and communicative language learning and

Ngày tải lên: 24/06/2015, 08:16

... A CASE-BASED REASONING APPROACH TO CONSTRUCTION SAFETY RISK ASSESSMENT GOH YANG MIANG NATIONAL UNIVERSITY OF SINGAPORE 2004 A CASE-BASED REASONING APPROACH TO CONSTRUCTION SAFETY RISK ASSESSMENT ... Manpower. To realize the second level of feedback, a novel case-based reasoning (CBR) approach of risk assessment was developed. The CBR approach was designed to facilitate the Job Hazard Analysis ... risk analysis; and... hierarchies Such an approach allows meticulous analysis to be executed 2.2.2 Failure Modes and Effects Analysis (FMEA), and Hazard and Operability Study (HAZOP) Failure

Ngày tải lên: 11/09/2015, 21:20

... also like to thank all friends in Multimedia lab especially to Koh Chunkeat, Dr. Zhao Yunlong, Lee Chee Wei, Feng Huamin, Xu Huaxin, Yang Hui, Marchenko Yelizavita and Chandrashekhara Anantharamu ... data for training One approach to tackle... other broadcast stations Hence, it is possible to adopt a learning-based approach to train a system to recognize the contents of each ... problem into parts and thus partially alleviates the data sparseness problem in vi machine learning. Our further analysis shows that as compared to HMM, the rule induction approach is easier to incorporate

Ngày tải lên: 11/09/2015, 21:49

... trial to evaluate its performance is another valuable line of the research, and equally valuable are inquires into the information-related educational reform policy on either national or local ... that set them above that requirement By using a multi-indicator approach, qualitative methods can complement quantitative approach (Denzin & Lincon, 2000; Patton, 2001) The purpose of qualitative ... side The major tasks to be performed at the stage of evaluation include instructional evaluation and usability evaluation All the stages stated above are carried out either sequentially or concurrently,

Ngày tải lên: 10/01/2020, 11:02

... fun”) that are rated on a 5-point scale from 1 (never) to 5 (almost always) The questionnaire distinguishes adaptive and mal-adaptive emotion regulation strategies Table 2 Overview of measures and ... there are six behavioral strat-egies (adaptive stratstrat-egies: relaxation, behavioral distraction, social support; maladaptive strategies: direct expression, in-direct expression, avoidance), and ... In addition, the received care-as-usual and additional help will be measured at T3 Analyses Data will be analyzed according to the intention-to-treat principle [63], with multiple imputation as

Ngày tải lên: 10/01/2020, 14:11

... • mIns/NAA height and area • mIns/Cho height and area • mIns/Cr height and area • NAA/Cho height and area • NAA/Cr height and area • Cho/Cr height and area • Lac/NAA height and area • Lac/Cho ... and area • Cho/Cr height and area • mIns/NAA height and area • mIns/Cho height and area • mIns/Cr height and area • NAA/Cho height and area • NAA/Cr height and area • Cho/Cr height and area • ... statistical analysis and critically revised the statistical analysis and the manuscript language MK participated in the acquisition of clinical data and critically revised the statistical analysis

Ngày tải lên: 01/02/2020, 21:26

... sexual changes will require adaptation by the man and the partner, likely use of sexual aids and a need to adopt a flexible approach to sexual interactions. Video: A sex therapist encourages the ... Individual items are summed into a total score A higher score means higher satisfaction Clinical data will be abstracted from patients’ health records, including PSA and clinical stage of prostate cancer ... which to navigate a sexual relationship [11] Some psy-chosocial factors can become potentially influential bar-riers to sexual recovery after prostate cancer treatment, such as unrealistic expectations

Ngày tải lên: 06/08/2020, 04:11

... legal issues is’ To understand international law and states’ behaviours, a law and economics approach can be better way or method rather than other methods of or approaches to international law ... shares the assumption with the neo-realism and institutionalism that a state is a unitary and rational actor in international field In a law and economics approach, states behave in order to maximize ... theoretically coherent and logical explanation, this paper will represent a law and economics approach as an answer the question ‘what the better way to understand international law and international

Ngày tải lên: 25/06/2021, 22:02

... meta- linguistic approach to teaching grammar, writing skills, grammatical constructions, and the teaching and learning of grammar The application of a cognitive meta- linguistic approach to teaching ... Cognitive-Maturational Approach (CMA) has established its relevance in ESL/EFL research, making it a valuable focus for this action research study.To enhance language acquisition, learners must be trained ... and evaluation skills. 2.1.2 Teaching and learning English grammar Nazav and Sama (2017) categorize grammar teaching into two main definitions: narrow and broad The narrow definition refers to

Ngày tải lên: 29/08/2021, 08:57

... temperature dependent changes may be expected over a physiologically relevant range Most studied metabolites in brain are Acetate, N-Acetyl aspartate (NAA), N-Acetylaspartylglutamate (NAAG), Alanine, ... glutamate, glutamine, γ-aminobutyric acid (GABA), and N-acetylaspartate, a putative neuronal maker, are all currently observable via phosphorus (31P), hydrogen (1H), and carbon (13C) MRS In addition ... water, and low signal -to- noise ratios The analysis of such data is greatly facilitated by incorporating priori spectral information in a parametric modeling approach Chemical shift and signal intensity...

Ngày tải lên: 10/11/2015, 11:35

... Approach By reviewing and comparing Product Approach, Process Approach and Genre Approach, weakness and strength of each approach are identified As Raimes (1983:11) mentions that all of the approaches ... questionnaire and some major findings have been found The current EFL writing approaches as Product Approach, Process Approach and Genre Approach were reviewed and their advantages and drawbacks ... language learning classroom and some genre-based teaching approaches have come into being However, there are strong similarities with product approaches and, in some ways, genre approaches can...

Ngày tải lên: 07/11/2012, 14:31

... perturbation-based approach to sensitivity analysis Numerical results 3.1 Design sensitivity analysis In this example, the perturbation-based sensitivity analysis approach (PSA) is applied to calculate ... differentiation approach based on the modified boundary integral equation presented by Rezayat and Burton [7] Based on this DSA, an optimal arrangement of circular holes is found to make the temperature ... a way that all unknowns are taken to the left side, i.e Au ¼ Bv (10) u is a vector of unknowns, and v is a known vector; A and B are matrices whose columns are a combination of columns of H and...

Ngày tải lên: 12/02/2014, 22:20