a little clarification is in order

In order to become competent in a foreign language

In order to become competent in a foreign language

... conversation structure: conversation analysis and discourse analysis 5 1.2.1 Conversation analysis Many conversational analysis researchers have defined ordinary conversation as the kind of casual, ... example, a teacher talking to a student in a classroom is one kind of interaction Others include a boss talking to his assistant at the workplace, a doctor to patient in a clinicThe basic pattern ... clarification In characterizing responding acts, Tsui (1994) asserts that not any move following an initiating move is a responding move An initiation can be followed by a move, which is totally...

Ngày tải lên: 09/04/2013, 08:49

42 571 0
Tài liệu Báo cáo khoa học: Expression of poly(A)-binding protein is upregulated during recovery from heat shock in HeLa cells doc

Tài liệu Báo cáo khoa học: Expression of poly(A)-binding protein is upregulated during recovery from heat shock in HeLa cells doc

... CGGTTCACTAAACGAGCTCTGCTGCAGaaaaaatccaaaaaaaatctaaaaaaatcttttaaaa aaccccaaaaaaatttacaaaaaaGTCGACaatgc gcattGTCGACttttttgtaaatttttttggggttttttaaaagatttttttagattttttttg gattttttCTGCAGCAGAGCTCGTTTAGTGAACCG Ccttctccccggcggttagtgctgagagtgc aaaaaatccaaaaaaaatctaaaaaaatcttttaaaaaaccccaaaaaaatttacaaaaaa ... Transcription start site β-gal AR S 5’-aaaaaatccaaaaaaaatctaaaaaaatcttttaaaaaaccccaaaaaaatttacaaaaaa-3’ (3) TOP-β-gal CMV Transcription start site β-gal Relative abundace of β-gal A PABP expression during ... aaaaaatccaaaaaaaatctaaaaaaatcttttaaaaaaccccaaaaaaatttacaaaaaa Primer with NcoI site Sense ARS with PstI and SalI Antisense ARS with PstI and SalI TOP ARS Acknowledgements This work was supported by funds from a...

Ngày tải lên: 18/02/2014, 12:20

19 599 0
Tài liệu Báo cáo khoa học: Cytochrome P450 Cyp4x1 is a major P450 protein in mouse brain doc

Tài liệu Báo cáo khoa học: Cytochrome P450 Cyp4x1 is a major P450 protein in mouse brain doc

... 5¢-CATGGACATAAGTCCTTTTCCCTTCCTCCT-3¢, and 4x1-12-pR, 5¢-AAACATAAATTTCGCCATTTCTCCTAG TAT-3¢ The full-length mouse cDNA was obtained with primers 4x1-f-pF, 5¢-ATGGAGGCCTCCTGGCTGGAG ACTCGTTGG-3¢ and 4x1-f-pR, 5¢-AAACATAAATTT CGCCATTTCTCCTAGTAT-3¢ ... protein was used to raise antisera in rabbit, which were able to detect  ng of the antigen (data not shown) As shown in Fig 5B, antisera detected a principal protein band of  55 kDa in brain ... mid-way along the chain Northern blot analysis showed high level expression of the CYP4x1 RNA in brain and in aorta, and this was confirmed by analysis of the EST database; this showed significant...

Ngày tải lên: 19/02/2014, 07:20

12 468 0
Tài liệu The Proof is in the Pudding - A Look at the Changing Nature of Mathematical Proof doc

Tài liệu The Proof is in the Pudding - A Look at the Changing Nature of Mathematical Proof doc

... formalism, and his methodology, has become the model—even to the present day—for establishing mathematical facts What is interesting is that a mathematical statement of fact is a freestanding ... trying things, and calculating things, and visualizing things, that were unthinkable fifty years ago Of course it should be borne in mind that mathematical thinking involves concepts and reasoning, ... modern mathematician: all the different fields of mathematics are as inseparable as the different parts of a living organism; as a living organism mathematics has to be permanently recreated; each...

Ngày tải lên: 21/02/2014, 09:20

334 515 0
Báo cáo khoa học: Cys126 is a completely conserved residue in triosephosphate isomerase that docx

Báo cáo khoa học: Cys126 is a completely conserved residue in triosephosphate isomerase that docx

... used for generating the five mutants were: C126S, 5¢-TAATTTAAAAGCCGTTGTATCCTTTGGT GAATCTT-3¢; C12 6A, 5¢-TAATTTAAAAGCCGTTGT AGCTTTTGGTGAATCTT-3¢; C126V, 5¢-TAATTTAAAA GCCGTTGTAGTTTTTGGTGAATCTT-3¢; ... 5¢-T AATTTAAAAGCCGTTGTAATGTTTGGTGAATCTT-5¢; and C126T, 5¢-TAATTTAAAAGCCGTTGTAACTTTT GG TGAATCTT-3¢ Experimental procedures Mutagenesis The Pf TIM gene was cloned into the pTrc9 9A vector pARC1008 ... mutants displaying a significantly lower degree of thermal stability This study suggested that Cys126 may be required for efficient folding and stability rather than being involved in maintaining...

Ngày tải lên: 14/03/2014, 23:20

12 395 0
Báo cáo khoa học: SLC39A14, a LZT protein, is induced in adipogenesis and transports zinc pptx

Báo cáo khoa học: SLC39A14, a LZT protein, is induced in adipogenesis and transports zinc pptx

... Ltd), a SLC3 9A1 4-specific forward primer: 5¢-CCCACTCAGTAGCTGTGT-3¢, 5¢-CAATGCTGGCAT GAGCAT-3¢ or 5¢-CTTCTTGGGGAAACATG-3¢, and a reverse primer: 5¢-CCAGCATAATGGAGAAGC-3¢, 5¢-AA CTGGACCCTAAGCCTA-3¢ ... primer AP-1: 5¢-CCATCCTAATACGACTCACTAT AGGGC-3¢ and a SLC3 9A1 4-specific reverse primer: 5¢-AACACCACTGCAGACTTGGAGACG-3¢ The PCR for 3¢-RACE was performed using the forward primer AP-1: 5¢-CCATCCTAATACGACTCACTATAGGGC-3¢ ... adipose tissue (WAT) and interscapular brown adipose tissue (BAT) isolated from adult male mice by Q-PCR WAT samples were fractionated into stromal-vascular cells and mature adipocytes As shown in...

Ngày tải lên: 30/03/2014, 16:20

10 327 0
Báo cáo Y học: Barley a-amylase Met53 situated at the high-affinity subsite )2 belongs to a substrate binding motif in the bfia loop 2 of the catalytic (b/a)8-barrel and is critical for activity and substrate specificity pot

Báo cáo Y học: Barley a-amylase Met53 situated at the high-affinity subsite )2 belongs to a substrate binding motif in the bfia loop 2 of the catalytic (b/a)8-barrel and is critical for activity and substrate specificity pot

... domain B) from AMY2 (in green) and TAA (in black) The superimpositioning was guided by the catalytic acids (D179AMY2, E204AMY2, and D289AMY2 and D206TAA, E230TAA, and D297TAA) The invariant Y51AMY2 ... mutagenesis of histidine 93, aspartic acid 180, glutamic acid 205, histidine 290, and aspartic acid 291 at the active site and tryptophan 279 at the raw starch binding site in barley a- amylase ... this endo-acting into an exo-acting a- amylase such as the natural maltotetraose-forming exo-amylase [10] or B stearothermophilus maltogenic a- amylase [23] Met53 was indicated in the modelled AMY2/maltodecaose...

Ngày tải lên: 31/03/2014, 08:20

14 558 0
the unfinished revolution how a new generation is reshaping family work and gender in america dec 2009

the unfinished revolution how a new generation is reshaping family work and gender in america dec 2009

... hardly seemed the same couple The separation had triggered a remarkable change in both Being away had given his father a new appreciation for his family and a deepening desire to be a “real family ... right partner and worried about balancing family and work amid mounting job demands and a lack of caretaking supports, they are developing second-best fallback strategies as insurance against their ... Reared on a farm in the rural Northeast, Hannah listened to her mother regularly complain—and blame her father—about lost chances and roads not taken: I hear about this ad nauseam! My mother was...

Ngày tải lên: 10/06/2014, 21:30

312 382 0
Báo cáo hóa học: " MMP-1 is a (pre-)invasive factor in Barrettassociated esophageal adenocarcinomas and is associated with positive lymph node status" doc

Báo cáo hóa học: " MMP-1 is a (pre-)invasive factor in Barrettassociated esophageal adenocarcinomas and is associated with positive lymph node status" doc

... Takeo S, Harada T, Okazawa T, Yanai H, Okita K: Matrix metalloproteinase-7 and matrix metalloproteinase-9 are associated with unfavourable prognosis in superficial oesophageal cancer Br J Cancer ... been available regarding clinicopathological factors in BE and EAC so far Our findings of an increased MMP-1 expression in EAC is well in line with results obtained in other cancer entities and ... Barrett metaplasia; GERD, Gastro-Esophageal Reflux Disease; EAC, esophageal adenocarcinomas; ESCC, esophageal squamous-cell carcinomas; †significance is related to GERD; ††significance is related...

Ngày tải lên: 18/06/2014, 16:20

11 648 0
Báo cáo sinh học: "A predicted protein, KIAA0247, is a cell cycle modulator in colorectal cancer cells under 5-FU treatment" ppt

Báo cáo sinh học: "A predicted protein, KIAA0247, is a cell cycle modulator in colorectal cancer cells under 5-FU treatment" ppt

... CTCATGCTTCTTTCAACAGTGG 82 F: CCATACCTCAAGTATTTGCCATC 67 R: TCCAGTCTTTCGTATTAATGATTCAG F: CATGGTGCACTTTCCTCCTT Cyclin B2 NM004701 F: GCATTATCATCCTTCTAAGGTAGCA (CCNB2) a R: TGTAATACTGCTGCTTTAAGTTCCA ... KIAA0247, in human gastrointestinal tissues and colonic cell lines Results indicated that KIAA0247 ubiquitously expresses in gastrointestinal tissues and in Huang et al Journal of Translational ... toxicity in a p53-independent manner in human glioblastoma cells Cancer Res 2001, 61:5843-5849 Robles AI, Bemmels NA, Foraker AB, Harris CC: APAF-1 is a transcriptional target of p53 in DNA damage-induced...

Ngày tải lên: 18/06/2014, 19:20

8 359 0
báo cáo hóa học: " Toll-like receptor 2 signaling is a mediator of apoptosis in herpes simplex virus-infected microglia" pdf

báo cáo hóa học: " Toll-like receptor 2 signaling is a mediator of apoptosis in herpes simplex virus-infected microglia" pdf

... used in the study: caspase-3: 5'gggcctgaaataccaagtca-3' and 5'-aaatgaccccttcatcacca-3'; Dsip1: 5'-ggtggccctagacaacaaga-3' and 5'-tcaagcagctcacgaatctg-3'; CIDE-B: 5' ctggaactcagctcctccac-3' and ... BCL2/adenovirus E1B-interacting protein Baculoviral IAP repeat-containing BCL2/adenovirus E1B-interacting protein Apoptosis inhibitor TSC22 domain family Cell-death inducing DNA fragmentation factor ... factor CASP2 and RIPK1 adaptor domain containing protein Fas-associated death domain Fas apoptotic inhibitory molecule Helicase lymphoid specific Interleukin 10 MAP kinase interacting protein C3HC...

Ngày tải lên: 19/06/2014, 22:20

7 508 0
báo cáo hóa học:" Use of Tranexamic acid is a cost effective method in preventing blood loss during and after total knee replacement" ppt

báo cáo hóa học:" Use of Tranexamic acid is a cost effective method in preventing blood loss during and after total knee replacement" ppt

... supervision, preparation of the questionnaire and collection and analysis of data TA was involved in the study design, analysis and was involved in critically reviewing the manuscript FA and MUC participated ... Chrishantha Abeysenaa HJdS: HIV in South Asia Medicine 2005, 33(6):42-43 28 Ali S, T W, Khan A: Viral hepatitis in children AFIP Rawalpindi, Pakistan; 1998 29 Linda E, Prescott PS: Global Distribution ... States and Europe, South Asia is not far behind with an estimated 40-50 thousand joint replacement procedures already done yearly in India alone [31] Number of knees replaced annually in Pakistan...

Ngày tải lên: 20/06/2014, 04:20

5 452 0
báo cáo hóa học:" Nuclear survivin expression is a positive prognostic factor in taxane-platinum-treated ovarian cancer patients" pdf

báo cáo hóa học:" Nuclear survivin expression is a positive prognostic factor in taxane-platinum-treated ovarian cancer patients" pdf

... 92:271-277 Athanassiadou P, Grapsa D, Athanassiades P, Gonidi M, Athanassiadou A- M, Tsipis A, Patsouris E: The prognostic significance of COX-2 and survivin expression in ovarian cancer Pathol Res Pract ... Kuragaki C, Ueda Y, Aki T, Ikegami H, Yamazaki M, Ito K, Nagamatsu M, Nishizaki T, Asada M, Kameda T, Wakimoto A, Mizutani T, Yamada T, Murata Y: Prognostic significance of p53 mutation in suboptimally ... Menicagli M, Cosio S, Naccarato AG, Genazzani AR, Bevilacqua G, Cavazzana AO: P53 gene status in patients with advanced serous epithelial ovarian cancer in relation to response to paclitaxel-plus...

Ngày tải lên: 20/06/2014, 08:20

9 408 0
Báo cáo hóa học: " A fixed point theorem for Meir-Keeler contractions in ordered metric spaces" pot

Báo cáo hóa học: " A fixed point theorem for Meir-Keeler contractions in ordered metric spaces" pot

... point is proved as in Theorem 2.7 Remark 3.3 A parallel result in the nonincreasing case cannot be obtained using a similar argument as in Theorem 2.3 because the proof that (xn) is a Cauchy ... Gnana Bhaskar, T, Lakshmikantham, V: Fixed point theorems in partially ordered metric spaces and applications Nonlinear Anal 65, 1379–1393 (2006) doi:10.1016/j.na.2005.10.017 Harjani, J, Sadarangani, ... that inf{d(x, Tx): x Î X} = This finishes the proof of (a) (b) Suppose that X is compact and T is continuous Taking into account that the mapping X → R+ x → d(x, Tx) is continuous and the fact...

Ngày tải lên: 20/06/2014, 22:20

8 404 0
Báo cáo hóa học: "MAXIMUM PRINCIPLES FOR A CLASS OF NONLINEAR SECOND-ORDER ELLIPTIC BOUNDARY VALUE PROBLEMS IN DIVERGENCE FORM CRISTIAN ENACHE " pptx

Báo cáo hóa học: "MAXIMUM PRINCIPLES FOR A CLASS OF NONLINEAR SECOND-ORDER ELLIPTIC BOUNDARY VALUE PROBLEMS IN DIVERGENCE FORM CRISTIAN ENACHE " pptx

... requires that Ω be a convex domain This restriction can, of course, be relaxed requiring that at each point of ∂Ω, the average curvature is nonnegative Derivation of maximum principles for Ψ In this ... However, in what follows, we will show that the maximum value of Φ(x ,a, b) must occur at a critical point of u, if Ω is a convex domain in RN Suppose that Φ(x ,a, b) takes its maximum value at P on ... Philippin, Some maximum principles for nonlinear elliptic equations in divergence form with applications to capillary surfaces and to surfaces of constant mean curvature, Nonlinear Analysis (1979),...

Ngày tải lên: 22/06/2014, 22:20

13 333 0
Is a little knowledge dangerous? docx

Is a little knowledge dangerous? docx

... studies have revealed that this type of persons is very rare So it is always good to know something well Gaining knowledge in a particular field will definitely make one a master in a subject Let ... and mighty They always feel that work is below their dignity The result is that they will be fired These people will become dejected, disappointed and confused Some people may disagree that a ... a little knowledge is not a dangerous thing On the other hand, it can motivate them to further their efforts to gain more knowledge This may be true in some cases But psychological studies have...

Ngày tải lên: 21/07/2014, 20:20

4 229 0
w