a key to achieving organizational objectives

Operations & Maintenance Best Practices - A Guide to Achieving Operational Efficiency docx

Operations & Maintenance Best Practices - A Guide to Achieving Operational Efficiency docx

... gas, and water consumption Advanced meters are defined as having the capability to measure and record interval data (at least hourly for electricity) and communicate the data to a remote location ... O&M measures can have immediate payback • These measures rarely require the design time, bid preparation, evaluation, and response compared to capital projects that can take up to a year to implement ... Laboratory, Richland, Washington National Research Council (NRC) 1998 Stewardship of Federal Facilities; A Proactive Strategy for Managing the Nation’s Public Assets National Academy Press, Washington,...

Ngày tải lên: 08/03/2014, 14:20

321 6,4K 1
Báo cáo khoa học: "A Key to Extensible Semantic Analysis" pdf

Báo cáo khoa học: "A Key to Extensible Semantic Analysis" pdf

... change" to "preparing for a sudden financial state change" "Crash" refers directly to the cause of the negative physical state change, and it is mapped onto an analogous cause of the financial state ... natural language, in case the reader is still in doubt about the necessity to analyze metaphor as an integral Dart of any comprehensive natural language system, I point out that that there are ... recognition and universality of acceptance in the underlying mappings That is, an analogy makes the basic mapping explicit (sometimes the additional transfer maps are also detailed), whereas in a metaphor...

Ngày tải lên: 17/03/2014, 19:20

6 270 0
Báo cáo khoa học: Mammalian transglutaminases Identification of substrates as a key to physiological function and physiopathological relevance pot

Báo cáo khoa học: Mammalian transglutaminases Identification of substrates as a key to physiological function and physiopathological relevance pot

... Esposito and I Caputo 132 Akagi A, Tajima S, Ishibashi A, Matsubara Y, Takehana M, Kobayashi S & Yamaguchi, N (2002) Type XVI collagen is expressed in factor XIIIa+ monocyte-derived dermal dendrocytes ... the art Minerva Biotec 14, 121–128 137 Nishiura H, Shibuya Y, Matsubara S, Tanase S, Kambara T & Yamamoto T (1996) Monocyte chemotactic factor in rheumatoid arthritis synovial tissue Probably a ... Esposito C, Pucci P, Amoresano A, Marino G, Cozzolino A & Porta R (1996) Transglutaminase from rat coagulating gland secretion Post-translational modifications and activation by phosphatidic acids...

Ngày tải lên: 30/03/2014, 15:20

17 441 0
báo cáo khoa học: " Non-coding RNAs: a key to future personalized molecular therapy?" docx

báo cáo khoa học: " Non-coding RNAs: a key to future personalized molecular therapy?" docx

... Plk1 regulation by miR-100 in human nasopharyngeal cancer Int J Cancer 2009, in press 89 Takeshita F, Patrawala L, Osaki M, Takahashi RU, Yamamoto Y, Kosaka N, Kawamata M, Kelnar K, Bader AG, Brown ... strongly upregulated in glioblastoma samples compared with normal brain controls [48] The data suggested that these miRNAs may act as antiapoptotic factors in human malignant disease In several types ... miRNA profile; a pancreatic ductal adenocarcinoma-related miRNA signature was defined [41] In a study on 65 resected pancreatic ductal adenocarcinomas with matched benign adjacent pancreas by...

Ngày tải lên: 11/08/2014, 12:20

10 333 0
Efficient logistics   a key to vietnams competitiveness

Efficient logistics a key to vietnams competitiveness

... Director, EASSD), Victoria Kwakwa (Country Director, EACVF), Jennifer Sara (Sector Manager, EASVS), Abhas Jha (Sector Manager, EASIN), and Paul Vallely (Senior Transport Specialist and Transport ... expressway sector He has also conducted public sector technical assistance and analytical work in transport and logistics in China, Malaysia, and Vietnam Prior to joining the World Bank he was an Associate ... Sarmiento (Resource Management Assistant, EAPCA), Iris David (Program Assistant, EASIN), Teresita Ortega (Program Assistant, EASWE), and Cristina Hernandez (Program Assistant, EASWE) provided excellent...

Ngày tải lên: 11/09/2014, 21:52

203 332 1
Job evaluation a guide to achieving equal pay

Job evaluation a guide to achieving equal pay

... for a regular formal review of evaluations to ensure that they are valid and consistent Employees should be allowed to appeal against an evaluation Advantages and disadvantages of points-factor ... consideration Analytical factor comparison Analytical factor comparison is also based on the analysis of a number of defined factors Role analysis takes place to assess the extent to which each of ... on applicant and comparator jobs The amended legislation stipulates that where both applicant and comparator jobs have already been evaluated under a fair and non-discriminatory job evaluation...

Ngày tải lên: 30/11/2015, 01:28

221 182 0
Job evaluation a guide to achieving equal pay

Job evaluation a guide to achieving equal pay

... for a regular formal review of evaluations to ensure that they are valid and consistent Employees should be allowed to appeal against an evaluation Advantages and disadvantages of points-factor ... consideration Analytical factor comparison Analytical factor comparison is also based on the analysis of a number of defined factors Role analysis takes place to assess the extent to which each of ... on applicant and comparator jobs The amended legislation stipulates that where both applicant and comparator jobs have already been evaluated under a fair and non-discriminatory job evaluation...

Ngày tải lên: 30/11/2015, 01:47

221 250 0
Tài liệu Streetsmart Guide to Valuing A Stock: The Savvy Investors Key to Beating the Market docx

Tài liệu Streetsmart Guide to Valuing A Stock: The Savvy Investors Key to Beating the Market docx

... fully reflect available information and are based on an accurate evaluation of all available information A random walk is a path that a variable takes, such as the observed price of a stock, where ... Ciord a and Emilio Goicoechea, Luis Arguelles and Merche Amezgaray, José Marí Marco and Carmela Garraleta, Fefa Vizcay and Héctor Ortiz, and Manolo Asiain: We thank you for your hospitality and ... Investors are assumed to be rational and calculating, to have identical beliefs and expectations of how the market works, and to have equal access to new information Investors are assumed to be...

Ngày tải lên: 21/12/2013, 01:19

289 615 1
The Key to a Winning Sales Message

The Key to a Winning Sales Message

... somewhere around $1 million a year." Needless to say, you'll need to back up that claim with additional facts and success stories However, rather than telling the customer that your product is "exciting" ... whether your sales message is any good Print it out and, with a red pen, circle every adjective and adverb (i.e telling) Then underline any facts that might actually spark an emotional response ... example: "Our customers have never experienced system outages that might keep them from taking online orders because we're the only vendor that offers 24 hour access fail-safe backup." That's a...

Ngày tải lên: 06/02/2014, 17:14

3 445 0
Báo cáo khoa học: Intrinsic local disorder and a network of charge–charge interactions are key to actinoporin membrane disruption and cytotoxicity ppt

Báo cáo khoa học: Intrinsic local disorder and a network of charge–charge interactions are key to actinoporin membrane disruption and cytotoxicity ppt

... calculation protocol Initially, 100 conformers were generated that were forced to satisfy the experimental data during a standard automatic cyana protocol based on simulated annealing using torsion ... side facing the membrane is dramatically changed (Fig 4) Finally, as 15N NMR relaxation can be used to characterize the dynamic properties of a protein in solution, relaxation data were obtained ... hypothesize that actinoporins act in at least two stages: (a) an initial approach to and binding of the membrane; (b) oligomerization, pore formation and lysis We also hypothesize that R29 and Y111...

Ngày tải lên: 14/03/2014, 23:20

10 376 0
Báo cáo Y học: Heterologous expression of a Rauvolfia cDNA encoding strictosidine glucosidase, a biosynthetic key to over 2000 monoterpenoid indole alkaloids pot

Báo cáo Y học: Heterologous expression of a Rauvolfia cDNA encoding strictosidine glucosidase, a biosynthetic key to over 2000 monoterpenoid indole alkaloids pot

... (5¢-GGAGGGTGGCAGCATGTCGTTCCTTGG GG-3¢, forward), GSP 5a (5¢-GTGGCTTCTTGAGTCAT AGAATCGTGGATGAC-3¢, reverse) and GSP5b (5¢-GT GCATACAACGAAGGCAATCGAGGTCC-3¢, reverse) using MarathonTM cDNA Amplification ... held at 72 °C for The primer pairs NcoI (5¢-GGTG GTCCAT GGACAATACTCAAGC-3¢, forward) – PstI (5¢-CTGCA GTTAGGTTTTTTGCCTCTTGACTAAC3¢, reverse) and NdeI (5¢-CACATATGGACAATACTCA AGCTGA GCC-3¢, forward) ... serum albumin (Merck, Darmstadt, Germany) as standard Strictosidine glucosidase activity was calculated on the basis of strictosidine decrease measured by HPLC A typical assay contained appropriate...

Ngày tải lên: 24/03/2014, 03:21

10 651 0
Báo cáo khoa học: Acylation of lysophosphatidylcholine plays a key role in the response of monocytes to lipopolysaccharide ppt

Báo cáo khoa học: Acylation of lysophosphatidylcholine plays a key role in the response of monocytes to lipopolysaccharide ppt

... Germany) The samples were separated using a solvent of chloroform/ methanol/water (65 : 35 : 7, v/v/v) Authentic lipid standards (Avanti Polar Lipids, Alabaster, AL, USA) were separated alongside ... peritoneal macrophages stimulated with the endomembrane Ca2+-ATP-ase inhibitor thapsigargin [34] They assumed this effect to be due to inhibition of CoA-independent acyltransferase activity as ... MonoMac-6 cells TNF -a mRNA was amplified in the NASBATM process and analyzed by polyacrylamide gel electrophoresis Dried gels were scanned on a Hewlett Packard photosmart scanner Results Stimulation...

Ngày tải lên: 31/03/2014, 01:20

7 324 0
báo cáo khoa học: " The transcription factor PHR1 plays a key role in the regulation of sulfate shoot-to-root flux upon phosphate starvation in Arabidopsis" potx

báo cáo khoa học: " The transcription factor PHR1 plays a key role in the regulation of sulfate shoot-to-root flux upon phosphate starvation in Arabidopsis" potx

... adaptations to altered sulphate compartmentalization BMC Plant Biol 2010, 10:78 Tomatsu H, Takano J, Takahashi H, Watanabe-Takahashi A, Shibagaki N, Fujiwara T: An Arabidopsis thaliana high-affinity ... SULTR1.1 and SULTR1.2, in Arabidopsis Plant Physiol 2008, 147:897-911 Maruyama-Nakashita A, Nakamura Y, Tohge T, Saito K, Takahashi H: Arabidopsis SLIM1 is a central transcriptional regulator of plant ... CA, Abel S: Attenuation of phosphate starvation responses by phosphite in Arabidopsis Plant Physiol 2001, 127:963-972 50 Varadarajan DK, Karthikeyan AS, Matilda PD, Raghothama KG: Phosphite, an...

Ngày tải lên: 11/08/2014, 11:21

10 430 0
7 key to creating a great relationship

7 key to creating a great relationship

... learned to walk That's the best advice we have to give If you want to create the relationship that you've always wanted, you have to be willing to risk opening your heart to another You have to ... www.soulmaterelationships.com www.quantri.vn Keys to Creating a Great Relationship fall as many times as was necessary until he or she learned to walk The baby didn't give up, even when it was hard, ... www.soulmaterelationships.com www.quantri.vn Keys to Creating a Great Relationship By no means does this mean that we have to everything together It does mean that if it’s important to our partner and...

Ngày tải lên: 26/04/2016, 10:02

20 305 0
w