a hybrid chip for genomics and proteomics

A hybrid expert system, clustering and ant colony optimization approach for scheduling and routing problem in courier services

A hybrid expert system, clustering and ant colony optimization approach for scheduling and routing problem in courier services

... Branch and Cut and Set-covering-based (Farahani et al., 2011) An example of a B&B can be found in Almoustafa et al (2013), where B&B is used to solve a VRP with distance constraints For ... local search while additionally including a solution evaluation, local searching tactics, termination criteria and elements such as tabus in a list and the tabu length (Jia et al., 2013); Ant ... the appointments can be arranged before delivery and have a specific date and time to serve (Toth & Vigo, 2002) The capacitated VRP (CVRP) involves the capacity constraint as the maximum load

Ngày tải lên: 14/05/2020, 22:28

28 21 0
A robust optimization approach for scheduling a supply chain system considering preventive maintenance and emergency services using a hybrid ant colony optimization and simulated annealing

A robust optimization approach for scheduling a supply chain system considering preventive maintenance and emergency services using a hybrid ant colony optimization and simulated annealing

... capacity accordingly Tavakkoli-Moghaddam et al (2007a) considered dynamic part demands and parts mixed for a reconfigurable part routing problem; minimizing operating (constant and variable), machine ... carrying levels, available labor levels, machine capacity and warehouse space, and the constraint of available budget Olugu and Wong (2012) proposed an expert fuzzy rule-based system for evaluating ... Khoushniat Aram c and Ahad Ali d a Department of Industrial Engineering, Kharazmi University, Tehran, Iran b Khaje Nasir Toosi University of Technology, Tehran, Iran c University Putra Malaysia, Malaysia

Ngày tải lên: 27/05/2020, 03:20

24 42 0
A hybrid model for predicting missile impact damages based on K-nearest neighbors and bayesian optimization

A hybrid model for predicting missile impact damages based on K-nearest neighbors and bayesian optimization

... No damage (0.0), Penetration (1.0), *N: Numerical variable; C: Categorical variable. Table 2 Brief experimental dataset Damage levels y1 Perforation Penetration Scabbing No damage Trang 6Doan, ... cross-validation loop All classes were over-sampled excluding the majority class, here, the perforation class In partic-ular, the no damage class, penetration class, and scabbing class were oversampled ... local impact on an RC target [19,38] Different levels of damages have been observed and introduced such as perforation, scabbing, radial cracking, spalling, cone cracking and plugging, penetration,

Ngày tải lên: 25/11/2020, 20:14

14 22 0
A hybrid arithmetic optimization algorithm and differential evolution for optimization of truss structures subjected to frequency constraints

A hybrid arithmetic optimization algorithm and differential evolution for optimization of truss structures subjected to frequency constraints

... (M), addition (A), and subtraction (S), are all used in AOA AOA is a mathematically implemented and modeled optimization algorithm that works in a vast scope of search spaces The exploration and ... iterations MOA is updated as follows: + From the formulations of MOA and MOP, it can be seen that MOA starts with a small value (nearly 0) and gradually increases after each iteration, eventually ... Despite the fact that ADE performs more evaluations than IDE and ANDE (6960 analyses for ADE, 6260 analyses for IDE and 6115 analyses for ANDE), the best solution obtained by ADE is supe-rior to

Ngày tải lên: 05/07/2022, 11:23

16 8 0
a hybrid particle swarm optimization and genetic algorithm with population partitioning for large scale optimization problems

a hybrid particle swarm optimization and genetic algorithm with population partitioning for large scale optimization problems

... The parameters c1 andc2 are acceleration constants, and they are a weighting stochastic acceleration, which pull each particle toward per-sonal best and global best positions The values ofc1andc2 ... Trang 1ENGINEERING PHYSICS AND MATHEMATICSA hybrid particle swarm optimization and genetic algorithm with population partitioning for large scale optimization problems Ahmed F Alia,b, Mohamed A ... population is called a swarm and the individuals are called particles In the search space, each particle moves with a velocity The particle adapts this velocity due to the information exchange

Ngày tải lên: 08/11/2022, 14:57

16 5 0
A REFERENCE GUIDE FOR ACADEMIC AND ADMINISTRATIVE PERSONNEL: administrative responsibilities handbook pot

A REFERENCE GUIDE FOR ACADEMIC AND ADMINISTRATIVE PERSONNEL: administrative responsibilities handbook pot

... plans,  and  approval  for  use  of  radiation  and  hazardous  B Designating  a  departmental  safety  coordinator  and  departmental  safety  committee  to  carry  out  department health and safety responsibilities.  ... Processes for assessing the quality of performance over time through ongoing monitoring of activities, and/or  separate  evaluations  provide  assurance that  controls  are  in  place  and  functioning  as intended.    Monitoring  includes  regular management and supervisory activities and actions taken by people in performing their duties.  ... support services, including expertise and assistance in interpreting policy  and  legal  requirements,  formal  and  informal  training,  and  compliance  monitoring.  Administrative  Officials  are  encouraged  to  contact 

Ngày tải lên: 29/03/2014, 20:20

55 490 0
data analysis and visualization in genomics and proteomics -  francisco azuaje

data analysis and visualization in genomics and proteomics - francisco azuaje

... Pruess and Rolf Apweiler 3 Data and Predictive Model Integration: an Overview Francisco Azuaje, Joaquı´n Dopazo and Haiying Wang 3.1 Integrative Data Analysis and Visualization: Motivation and Approaches ... demonstrate (a) how dataanalysis techniques can facilitate more comprehensive, user-friendly data visualiza-tion tasks and (b) how data visualization methods may make data analysis a moremeaningful and ... systemsinterrelate IntAct is an open source protein interaction database and analysis system It holds interaction data, maintains annotation standards and provides search andanalysis software (Hermjakob

Ngày tải lên: 08/04/2014, 12:45

269 392 0
genomics and proteomics functional and computational aspects - sándor suhai

genomics and proteomics functional and computational aspects - sándor suhai

... ACEDB (A Caenorhabditis elegansdatabase) as our database manage-ment system (Durbin and Thierry-Mieg, 1991) ACEDB is publically available and widelyused in many genomic centers, its basic data ... therefore required to apply analytic methods and data filtration and then organize the presentation of the data in ways that highlight the various patterns being examined Trang 26Obtaining and Evaluating ... 37and Stanley A Sawyer 5 Automatic Assembly and Editing of Genomic Data 6 QUEST: An Iterated Sequence Databank Search Method 51 B Chevreux, T Pfisterer, and S Suhai 67William R Taylor and

Ngày tải lên: 08/04/2014, 13:05

246 342 0
a legal guide for lesbian and gay couples 11th (2002)

a legal guide for lesbian and gay couples 11th (2002)

... repugnant to many people Same-sex lovers planning to adopt face additional potential barriers: • state laws barring adult adoptions—Alabama, Arizona, Hawaii, Michigan, Nebraska and Ohio all... ... Fred was a friend and colleague of Hayden’s,... are many similar experiences in being a lesbian and being a gay man (calling a lesbian a ‘Dyke’ and calling a gay man a ... sodomy law Maryland No sodomy law Massachusetts Heterosexual and homosexual sodomy illegal 20 years Michigan Heterosexual and homosexual sodomy illegal 15 years Minnesota Heterosexual and

Ngày tải lên: 18/04/2014, 14:03

264 519 0
báo cáo hóa học: "A binary method for simple and accurate two-dimensional cursor control from EEG with minimal subject training" potx

báo cáo hóa học: "A binary method for simple and accurate two-dimensional cursor control from EEG with minimal subject training" potx

... calculated each Bhattacharyya dis-tance according to (1), where M i and Σi are the mean vec-tor and covariance matrix of class i ( = 1,2), respectively [18] As we measured the Bhattacharyya distance ... females and one male, with ages ranging from 24–55 years Subject A was female, age 53 years Subject B was female, age 55 years Subject C was female, age 24 years Subject D was male, age 32 years ... which was about 3 cm from C3, and calculated band power on C3 for the referenced signal To determine the optimum spatial location and frequency band for discrimination, we conducted a feature analysis

Ngày tải lên: 19/06/2014, 08:20

16 489 0
Báo cáo hóa học: " Application of a MANET Testbed for horizontal and vertical scenarios: performance evaluation using delay and jitter metrics" potx

Báo cáo hóa học: " Application of a MANET Testbed for horizontal and vertical scenarios: performance evaluation using delay and jitter metrics" potx

... RESEARCH Open Access Application of a MANET Testbed for horizontal and vertical scenarios: performance evaluation using delay and jitter metrics Masahiro Hiyama 1* , Elis Kulla 1* , Tetsuya Oda ... function. We can save the data for these parameters in a text file and can Figure 2 Horizontal obstacle topology scenarios. A: HOS, B: HOM. Hiyama et al . Human-centric Computing and Information Sciences ... several fields such as collaborative computing and communications in indoor areas. Mobility and the absence of any fixed infrastructure make MANETs very attractive for mobility and rescue operations

Ngày tải lên: 21/06/2014, 06:20

14 473 0
báo cáo hóa học:" Research Article A Formal Model for Performance and Energy Evaluation of Embedded Systems" pot

báo cáo hóa học:" Research Article A Formal Model for Performance and Energy Evaluation of Embedded Systems" pot

... estimation A tool, named PECES, was implemented for automatizing the method Additionally, a measuring platform, named AMALGHMA, was constructed for characterizing the platform and for comparing ... The AMALGHMA (Advanced Measurement Algorithms for Hardware Architectures) tool has been implemented for automating the measuring activities AMALGHMA adopts a set of statistical methods, such as ... executed, measured, and then the obtained data were statistically analyzed For example, to capture the average power consumption when a MAM miss occurs, an assembly code that forces MAM misses was designed

Ngày tải lên: 21/06/2014, 11:20

12 490 0
báo cáo hóa học:" SimReg1 is a master switch for biosynthesis and export of simocyclinone D8 and its precursors" docx

báo cáo hóa học:" SimReg1 is a master switch for biosynthesis and export of simocyclinone D8 and its precursors" docx

... TAGAATTCCGCGGTTCGGCAGA simX5D3R TAGAATTCGCGACAGGAGCCATA simEXX4R TAGAATTCTCAGAACATCGTCC SR2ExXR TTTGAATTCTTGACCACCACTTC simA7R ATAAGCTTGTCGATACCGATCTTC D4For TATTGGTCGCGCAGTCGTCC DNA-shift assay part of the simD4 ... simD4_for_script AAATCTAGAGGCGACCGACCCCG GCCGAG simD4 promoter cloning P D4 simD4_rev_script AAAGGTACCCGATCCGGCTGGCA TTACTG simReg1_for AAAAAGCTTTACCTGTATCCAGGGC GGGCACTT simReg1_ rev AAAGGATCCGCACAAAGCGGCAGC ... in a reac-tion mixture) were tested as SimReg1 ligands Table 2 Primers used in this study SSR1R TTTGAATTCATTAATGGTGATGGT purification SR1D4R TAGAATTCCATTGTGAACCATC SD2R1R TAGAATTCCGCGGTTCGGCAGA

Ngày tải lên: 21/06/2014, 17:20

12 456 0
Báo cáo hóa học: " Research Article On Strong Convergence by the Hybrid Method for Equilibrium and Fixed Point Problems for an Inifnite Family of Asymptotically Nonexpansive Mappings" potx

Báo cáo hóa học: " Research Article On Strong Convergence by the Hybrid Method for Equilibrium and Fixed Point Problems for an Inifnite Family of Asymptotically Nonexpansive Mappings" potx

... of Tada and Takahashi 19, Inchan and Plubtieng 16, Zegeye and Shahazad 18, and many others. 2. Preliminaries We will use the following notations: 1 “” for weak convergence and “ → ” for ... results of Nakajo and Takahashi 14 and Kim and Xu 15. On the other hand, for finding a common element of EPφ∩FS, Tada and Takahashi 19 introduced the following iterative scheme by the hybrid ... point iteration processes for nonexpansive mappings and asymptotically nonexpansive mappings in Hilbert spaces and Banach spaces including Mann 11 and Ishikawa 12 iteration processes have been

Ngày tải lên: 21/06/2014, 20:20

20 275 0
plant genomics and proteomics -  christopher a. cullis

plant genomics and proteomics - christopher a. cullis

... Genus Cardamine Arabidopsis Rosa Luzula Oryza Rosa Gnetum Zea Nicotiana Ginkgo Allium Pinus Fritillaria Species 1C pg amara thaliana wichuraiana pilosa sativa moyesii ula mays tobaccum biloba sativum ... databases that house all this information so that the data can be accessible both immediately and in an archival form D ATABASES The creation of biological databases represents a fundamental change ... experimental detail and observations span very diverse plant material, rather than all being available in a convenient single model organism Thus algae may be appropriate models for photosynthesis and...

Ngày tải lên: 08/04/2014, 13:07

218 323 0
Báo cáo hóa học: " Strong convergence of a hybrid method for monotone variational inequalities and fixed point problems" ppt

Báo cáo hóa học: " Strong convergence of a hybrid method for monotone variational inequalities and fixed point problems" ppt

... inequalities Carpathian J Math 24, 139–148 (2008) He, BS, Yang, ZH, Yuan, XM: An approximate proximal-extragradient type method for monotone variational inequalities J Math Anal Appl 300, 362–374 ... nonlinear variational problems Springer, New York (1984) Iusem, AN: An iterative algorithm for the variational inequality problem Comput Appl Math 13, 103–114 (1994) Yao, JC: Variational inequalities ... contributions All authors participated in the design of the study and performed the converegnce analysis All authors read and approved the final manuscript Competing interests The authors declare that they...

Ngày tải lên: 20/06/2014, 22:20

10 425 0
A Hybrid Method for a System Involving Equilibrium Problems Variational Inequalities and Nonexpansive Semigroup

A Hybrid Method for a System Involving Equilibrium Problems Variational Inequalities and Nonexpansive Semigroup

... Hilbert spaces, Journal of Mathematical Analysis and Applications 318 (2006) 43–52 [10] N Nadezhkina and W Takahashi, Strong convergence theorem by a hybrid method for nonexpansive mappings and Lipschitz ... the variational inequality (2) and the fixed point problem for a group of nonexpansive mappings are important topics of Applied Analysis, and they attracted much attention of researchers and users ... (x) 2 for all x, y ∈ H; for any x ∈ H and for all y ∈ C Using Lemma 2.1, it is easy to prove the following lemma Lemma 2.2 A point u ∈ C is a solution of the variational inequality (2) if and...

Ngày tải lên: 14/10/2015, 08:17

16 178 0
Tài liệu Báo cáo khoa học: A facile method for expression and purification of the Alzheimer’s disease-associated amyloid b-peptide pdf

Tài liệu Báo cáo khoa học: A facile method for expression and purification of the Alzheimer’s disease-associated amyloid b-peptide pdf

... 5¢-CACAACGCCACCAACCATCAGA CCGATGATAGCACCCTTGTTAGAACCCAC-3¢; Abstart, 5¢-GCGTAGGGTCGACATATGGACGCTGAATT CCGTCACG-3¢; Abstop, 5¢-CCTGCCGAGCTCCTATTA CACAACGCCACCAACCATCAG-3¢ The PCR solution was prepared ... guidelines and using the following primers: Aba, 5¢-ATGGACGCTGAAT TCCGTCACGACTCTGGTTACGAAGTTCACCACCAG AAGCTGGTG-3¢; Abb, 5¢-GTTCACCACCAGAAGCT GGTGTTCTTCGCTGAAGACGTGGGTTCTAACAAG GGTGCT-3¢; Abc, 5¢-CACAACGCCACCAACCATCAGA ... enzyme, and contained Aba, Abb and Abc at 40 nm each, and the start and stop primers Abstart and Abstop at 600 nm each, and 200 lm each of dATP, dCTP, dGTP and dTTP The product was separated from...

Ngày tải lên: 18/02/2014, 13:20

16 691 0
Tài liệu Báo cáo khoa học: Development of a new method for isolation and long-term culture of organ-specific blood vascular and lymphatic endothelial cells of the mouse pdf

Tài liệu Báo cáo khoa học: Development of a new method for isolation and long-term culture of organ-specific blood vascular and lymphatic endothelial cells of the mouse pdf

... SV40T Ag and the 3¢ portion of the tsA58T Ag cDNA carrying the A4 38V mutation were PCR-amplified from COS-7 cDNAs using the following primers: LTA-1F, 5¢-CTC GAGATGGATAAAGTTTTAAACAGAG-3¢ and LTA1R, ... GAGATGGATAAAGTTTTAAACAGAG-3¢ and LTA1R, 5¢-TGAAGGCAAATCTCTGGAC-3¢ for the former, and LTA–M2F, 5¢-CAGCTGTTTTGCTTGAATTATG-3¢ and LTA–2R, 5¢-GAATTCATTATGTTTCAGGTTCA GGGG-3¢ for the latter The PCR products were ... Dong QG, Bernasconi S, Lostaglio S, De Calmanovici RW, Martin-Padura I, Breviario F, Garlanda C, Ramponi S, Mantovani A & Vecchi A (1997) A general strategy for isolation of endothelial cells from...

Ngày tải lên: 18/02/2014, 17:20

11 875 0
Tài liệu A Marketing Guide for Small and Medium Sized Primary Forest Products Processors pdf

Tài liệu A Marketing Guide for Small and Medium Sized Primary Forest Products Processors pdf

... Specialty Product A B C D Mass Market Niche Market F Bibliography Essel, A E 1993 Niche marketing—An alternative for small and part-time farmers Farm Management Update Blacksburg, VA: Virginia Tech ... Graduate Research Assistant Department of Wood Science and Forest Products Virginia Polytechnic Institute and State University Blacksburg, VA Published by: Northeastern Area State and Private Forestry ... instead They were transformed into marketing managers, marketing engineers and marketing associates, and some even became marketing representatives.” —Lamont C Blake Marketing Consultant As can...

Ngày tải lên: 18/02/2014, 22:20

92 2,2K 0
w