a historic evolution of the concept of light

... membrane-buried negative charges that are essential for binding the ion and also for the rotational mechanism of the ring The c ring of I tartaricus has 11 negative charges that are equally distributed ... SDS–PAGE, with an apparent molecular mass of 57–59 kDa, depending on the acrylamide concentration used (Fig 1A) Western blotting analyses of the intact as well as the denatured c rings revealed the ... with a total of 22 transmembrane helices This value is identical to the value obtained for the other Na+ F1F0 ATP synthases Additionally, the size of the A woodii ˚ c rings (approximately 58 A by...

Ngày tải lên: 18/02/2014, 17:20

... undergraduate students The goal of each volume is to encapsulate the current state of knowledge in a particular area of finance so that the reader can quickly achieve a mastery of that special area ... describe the current state of financial research and practice in a particular area of finance The essays in each volume are intended for practicing finance professionals, graduate students, and advanced ... by the downfall of Long-Term Capital Management (LTCM) in 1998 All of these events raised fears of a global economic meltdown Also notable at the end of 1998 was the creation of the financial...

Ngày tải lên: 18/02/2014, 18:20

... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTAATTTTATGCTGACTCAGCCCCA CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTGCC CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAAGAGACGGTGACCATTGTCCC CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTTCC ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCGTGATGACCCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAACGACACTCACGCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAATTGTGCTGACTCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTCAGCTCGTGTTGACGCAGCCGCC ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCCAGATGACCCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGATGTTGTGATGACTCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAATTGTGTTGACGCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCGTGATGACCCAGTCTCC...

Ngày tải lên: 23/03/2014, 13:20

... suggests that C paradoxa PsbU has a higher homology with the red algal protein than with the cyanobacterial one The C paradoxa thylakoid membranes also contained a band cross-reacted with anti-(R-PsbQ¢), ... Chloroplast DNA Cyanidium caldarium Chloroplast DNA Bacillariophyceae (diatoms) Thalassiosira pseudonana Nuclear DNA Chloroplast DNA Odontella sinensis Chloroplast DNA Prasinophyceae Mesostigma viride ... merolae Based on this they pointed out that the evolutionary history of the water oxidation domain in the red algae may be more complex as biochemical data suggests that the red alga C caldarium has...

Ngày tải lên: 23/03/2014, 15:21

... study, data triangulation was used to combine the advantages of analyzing data at certain times and with different research analysts Field analysis recorded immediate observations of the moderator, ... session The results were coded and entered into a database using Atlas.ti, a qualitative research software package In our analysis, we examined and used the data collected from each round of testing ... consumers about privacy laws and financial institutions’ sharing practices in a factual and neutral way The language could and should not direct a consumer to make any particular decision Through the...

Ngày tải lên: 29/03/2014, 18:20

... 5¢-GTGTAGCGCGCGTGCG GCCC-3¢ The forward and reverse primers, respectively, for CaS were 5¢-AAATGGCAACGAAGTCTTCAC-3¢ and 5¢-CAGTCGGAGCTAGGAAGGAA-3¢ Isolation of plasma membrane, intact chloroplasts, ... (AY341888) was amplified by PCR using PfuTurbo CX Hotstart DNA polymerase (Strategene, La Jolla, CA, USA) and the uracil-containing primers nt114 (forward: GGCTTAAUATGGCTATGGCGGAAATGG CAACGA) and ... phosphothreonine-specific antibody revealed the absence of the 40 kDa CaS phosphorylation in the stn8 mutant (Fig 4A) Analysis of the same fractions with CaSspecific antibody revealed similar levels of CaS in all samples...

Ngày tải lên: 30/03/2014, 04:20

... required at the bottom of the stack to manage the hardware and support the layers of software protocols all the way up to the phone-signaling stack Treating the phone as a black box encapsulated by a ... Compaq and Sharp (The Communicator was classified by market analysts as a PDA, partly because it had a keyboard, but also partly because Symbian phones really were a new category, and analysts didn’t ... Bollen, was the lack of real hardware Software development started well ahead of the availability of any prototype hardware but even by mid-1995, when the software project was in full swing, the device...

Ngày tải lên: 01/06/2014, 11:21

... 1998) Health in the Office Studies show that the proper use of daylighting decreases the occurrence of headaches, SAD, and eyestrain (Franta and Anstead 1994) Headaches and SAD are related to ... above the 10% increase of the average The Selma seventh graders also had improvements and reported a 32% increase, exceeding the 15% increase of the county average Table Average of Reading/Math ... California, had approximately one-third of the store under skylights after a 1992 renovation According to a manager of the Fullerton Target in 2001, there are no disadvantages to the natural light...

Ngày tải lên: 02/06/2014, 09:22

... National Physical Laboratory 5.4 The National Bureau of Standards 5.5 Colour at the national laboratories 5.6 Tracing careers 5.7 Weighing up the national laboratories 5.8 Industrial laboratories ... it, cast a shadow at no greater distance than an inch.’ During the eclipse, on the other hand, the lantern cast a very perceptible light, and the shadow was made at a distance of inches from the ... relate solar and stellar brightness By estimating a factor for the amount of sunlight Saturn received, he made a reasonable estimate of the distance of Sirius32 Theoretical calculations of planetary...

Ngày tải lên: 05/06/2014, 11:28

... and NA (A) Seasonal amino acid next (A) Seasonal amino acid distances of H3N2 HA and NA proteins since 1999 and (B) amino acid distances of H3N2 HA and NA from one season to the next The same ... LPN and AF contributed reagents and materials AFO supervised the research Further LPN and AF critically revised the manuscript and AF gave the final approval for publication All authors read and ... Europe are made public Methods Human samples A total of 234 Danish human nasal swab suspensions or nasopharyngeal aspirates positive for influenza A, from 1999 to 2006, were available at the WHO National...

Ngày tải lên: 20/06/2014, 01:20

... the accuracy and quality of available data, while target conditions are the distance and orientation of the flight with respect to radar, motion state of aircraft (uniform velocity, turning, accelerating), ... groundspeed, range, orientation of the trajectory with respect to the radar (radial and tangential projection of velocity heading), magnitude of the transversal acceleration, and magnitude of the groundspeed ... CV2), and maximum RMSE during maneuver (PV) The design of a tracking filter aims at attaining a satisfactory trade-off among all specifications The quality of the design will be evaluated by means of...

Ngày tải lên: 23/06/2014, 00:20

... Parallel changes in developmental divergence and conservation along branches leading to evolutionarily derived life histories can provide a deeper understanding of the role that adaptation has ... pooled larval/pupal, and adult), sequence data from five species in the melanogaster subgroup, and thousands of randomly selected genes to examine how selective constraint changes as a function of ... Construction and Ideological Reconstruction of Darwin’s Theory Chicago: University of Chicago Press; 1992 Raff RA: The Shape of Life: Genes, Development, and the Evolution of Animal Form Chicago: University...

Ngày tải lên: 06/08/2014, 19:20

... analysis) was in the calculated interval, but, for Ca, there was a loss of 9.7 kg·ha–1 instead of a gain of 5.2, and, for Mg, the actual gain, 14.1 kg·ha–1, was much lower than the theoretical one ... compare the values of OH mass obtained in 1986 and 1996 correctly, as well as the chemical composition of the A horizon (because a little OH material was sampled with A) , the weight of the OH sampled ... steady state, and theoretically able to increase exchangeable elements in mineral horizons Data were drawn from Table V A theoretical balance for mineral horizons was calculated by adding together...

Ngày tải lên: 08/08/2014, 00:21

... only patients on antimicrobial and other therapies that can alter the balance of the gut microbiota (for example, antacid/proton pump inhibitors and non-steroidal anti-inflammatory drugs), but also ... with a loop and inoculated into the top to mm of BHI agar in the glass vial These were then left overnight in the anaerobe chamber; the vials were then removed from the anaerobe chamber and photographed ... manuscript Additional data files The following additional data are available with the online version of this paper: CDSs specific to PCR-ribotype 027 isolates (Additional data file 1); CDSs that have...

Ngày tải lên: 09/08/2014, 20:20

... had many bacterial genes, partly explaining the observed pattern The case of the archaeal(-like) parent is far more difficult than that of the bacterial ancestor(s) as there are no data on the ancestral ... Possible archaeal origins of eukaryotic genes The archaeal tree is shown as a bifurcation of Euryarchaeota and the putative second major branch combining Crenarchaeota, Thaumarchaeota, and Korarchaeota ... the endonuclease Dicer, consists of two bacterial RNAse III domains and a helicase domain of apparent euryarchaeal origin, and the other essential protein, Argonaute, also shows a euryarchaeal...

Ngày tải lên: 09/08/2014, 20:21

... data collection methods and/or data analysis In at least four of these six cases, the qualitative data were not the only focus of the paper In these 14 trials, lay health worker programmes had ... including a discussion of the qualitative data and the choice of quantitative outcome measures Figure Example of a qualitative study carried out alongside a randomised trial: lay health workers for families ... workers and other research team members An experienced qualitative researcher carried out a thematic analysis of the data The qualitative study concluded that parents generally reported high satisfaction...

Ngày tải lên: 10/08/2014, 10:23

... appear normal and the low density area may not be apparent Some early signs of acute MCA infarction are loss of definition of the grey/white interface in the lateral margins of the insula, leading ... potential confusion with subarachnoid haemorrhage Below, we summarise the findings and analysis of CT scanning of the brain Normal brain and fundamentals of CT interpretation The brain normal grey/white ... brain The initial CT (Figure 1) was performed hours after the collapse The hospital had access to a magnetic resonance imaging (MRI) scanner once a week and the next available slot was days later...

Ngày tải lên: 11/08/2014, 23:21

... appeared such as the growth of the population and globalization may also facilitate a faster evolution This may be the reason why the evolutionary rates of Hu2 and Sw2 are higher than those of ... MEGA (ver 4) [74] Evolutionary Rate The evolutionary rate of each lineage was calculated To calculate the rate, at least one sequence of each subtype in each year was selected from each dataset ... YF carried out all analyses and drafted the manuscript AS, TK, and HO participated in the design of the study and helped to draft the manuscript All authors have read and approved the final manuscript...

Ngày tải lên: 12/08/2014, 04:21

... (days): mean ± SD (median) Mean APACHE II score SOFA score at day of infection SOFA MAX ICU, intensive care unit; LOS, length of stay; SD, standard deviation; SOFA, sequential organ failure assessment; ... also allows an evaluation of the adequacy of antibacterial treatment as the CRP plasma levels decreased by 50% within 3.3 days in patients receiving adequate treatment [16] One can wonder whether ... PD and MM originated the study and contributed to the analysis of data PD, JCP and CG prepared the paper CG and MN collected the data, and JLC, DL and JCP enrolled the patients All authors read...

Ngày tải lên: 12/08/2014, 23:23