a heterogeneous structure involved in reward processing motivation and decision making

Tài liệu Báo cáo Y học: Granule-bound starch synthase I A major enzyme involved in the biogenesis of B-crystallites in starch granules ppt

Tài liệu Báo cáo Y học: Granule-bound starch synthase I A major enzyme involved in the biogenesis of B-crystallites in starch granules ppt

... 4–16 and 21–29 correspond to independent recombinant strains obtained from a cross involving CS9 and IJ2 parental strains ability of GBSSI to extend amylopectin outer chains Again this coincides ... recombinants in a cross involving strain IJ2 (sta2-29::ARG7 sta3-1) and an interfertile ecotype of C reinhardtii known as C smithii (strain CS9) This latter is wild-type regarding starch accumulation ... obtain more information about the 5¢ end of this cDNA, an RT-PCR amplification was done using a specific primer 5¢-CGCAAACACCTCGCTGGCAC and a degenerated primer 5¢-AAGACSGGYGGYCT corresponding...

Ngày tải lên: 22/02/2014, 07:20

11 559 0
Báo cáo khoa học: RNA-binding properties of HCF152, an Arabidopsis PPR protein involved in the processing of chloroplast RNA pdf

Báo cáo khoa học: RNA-binding properties of HCF152, an Arabidopsis PPR protein involved in the processing of chloroplast RNA pdf

... calibrated with the following protein standards: thyroglobolin, 669 kDa; catalase, 232 kDa; aldolase, 158 kDa; bovine serum albumin, 67 kDa and casein, 30 kDa Analyzing the protein–protein interaction ... motifs (A) RNA-binding of the HCF152 and truncated parts containing different amounts of PPR motifs were analyzed in a UVcrosslinking assay to [32P]BDd RNA Increasing amounts of proteins, as indicated ... been characterized as proteins involved in RNA and DNA metabolisms [20–27] Two are characterized as DNA-binding factors [24,25], and therefore it appears that the PPR motif could be involved in both...

Ngày tải lên: 17/03/2014, 10:20

12 404 0
Báo cáo Y học: Fusion of farnesyldiphosphate synthase and epi-aristolochene synthase, a sesquiterpene cyclase involved in capsidiol biosynthesis in Nicotiana tabacum docx

Báo cáo Y học: Fusion of farnesyldiphosphate synthase and epi-aristolochene synthase, a sesquiterpene cyclase involved in capsidiol biosynthesis in Nicotiana tabacum docx

... 5¢-ATGGATCCGGAATGAGTAGTACCGATCTG-3¢ 5¢-TAGGATCCAATTTTGATGGAGTCCAC-3 5¢-ATGGATCCGGAATGGCCTCAGCAGCAGTT-3¢ FPPS N-terminal FPPS C-terminal eAS N-terminal eAS C-terminal FPPS C-terminal FPPS N-terminal ... Template P1 P2 P3 P4 P5 P6 P7 P8 5¢-TAGATCCATGGGTAGTACCGATCTG-3¢ 5¢-CTACTCGAGCTACTTTTGCCTCTTGTA-3 5¢-TAGAGCCATGGCCTCAGCAGCAGTT¢-3¢ 5¢-CTACTCGAGTCAAATTTTGATGGAGTC-3¢ 5¢-TAGGATCCCTTTTGCCTCTTGTAAAT-3¢ ... FPPS N-terminal eAS C-terminal eAS N-terminal was cleaved with the same enzymes and treated with alkaline phosphatase Vector and the fragment were isolated from agarose gel bands using the JETQUICK...

Ngày tải lên: 24/03/2014, 03:21

8 410 0
Báo cáo khoa học: Relaxin-3⁄ insulin-like peptide 7, a neuropeptide involved in the stress response and food intake Masaki Tanaka pptx

Báo cáo khoa học: Relaxin-3⁄ insulin-like peptide 7, a neuropeptide involved in the stress response and food intake Masaki Tanaka pptx

... and the area dorsal to the substantia nigra in the midbrain reticular formation By immunostaining using monoclonal antibody against the N-terminus of the human relaxin-3 A- chain [2], relaxin-3-immunoreactive ... metabolism Actions of relaxin-3 at the hypothalamo-pituitarygonadal (HPG) axis Fig Effect of intracerebroventricular administration of relaxin-3 in satiated male Wistar rats (A) Effect of human relaxin-3 ... regulation of the HPG axis was reported in that intracerebroventricular (5 nmol) and intra-PVN (540–1620 pmol) administration of relaxin-3 in adult male rats significantly increased plasma luteinizing...

Ngày tải lên: 29/03/2014, 21:20

8 370 0
Factors influencing borrower’s behavior and decision making patterns in the success of a micro finance model

Factors influencing borrower’s behavior and decision making patterns in the success of a micro finance model

... behavioral and attitudinal aspects of individuals An in- depth analysis in each of the broad parameters revealed the following: Educational Facet Education plays a vital role in shaping up a personality ... data was tabulated and analyzed through qualitative analysis of the gathered data, which reveal the behaviors and decision making patterns in lower income populations towards regulated microfinance ... needs and matching their expectations The academia in Pakistan may facilitate the MFIs in producing relevant research work in understanding the broader social paradigms of borrowers, which may actually...

Ngày tải lên: 06/09/2013, 05:48

23 555 0
Tài liệu Treating Equals Unequally: Incentives in Teams, Workers'''' Motivation and Production Technology potx

Tài liệu Treating Equals Unequally: Incentives in Teams, Workers'''' Motivation and Production Technology potx

... potentially eciency-enhancing The main reason for this is that asymmetric rewards facilitate coordination, because workers can anticipate that those who have high stakes at hand will certainly ... Liebrand (1984); see also Beckenkamp (1995) for an early application in Economics 13 The experiment was programmed in Pascal using RATimage by Abbink and Sadrieh (1995) The questionnaire and the ... positions The Institute for the Study of Labor (IZA) in Bonn is a local and virtual international research center and a place of communication between science, politics and business IZA is an independent...

Ngày tải lên: 22/02/2014, 09:20

34 390 0
Báo cáo khoa học: Cotton GhMPK2 is involved in multiple signaling pathways and mediates defense responses to pathogen infection and oxidative stress doc

Báo cáo khoa học: Cotton GhMPK2 is involved in multiple signaling pathways and mediates defense responses to pathogen infection and oxidative stress doc

... and negatively mediate pathogen signal transduction [9] In tobacco, salicylic acid (SA)-induced protein kinase and woundinduced protein kinase, two MAPKs in group A, were activated by inoculation ... phosphorylation of a MAPKKK, a MAPKK, and a MAPK [5] The phosphorylation and activation of an MAPK can lead to changes in its subcellular localization and its interaction with transcriptional effectors, ... It has been shown that Arabidopsis thaliana AtMPK1 and AtMPK2 are induced by wounding, jasmonic acid (JA), abscisic acid (ABA), and H2O2 [22–24] The expression patterns of pea PsMPK2 in Arabidopsis...

Ngày tải lên: 14/03/2014, 23:20

12 348 0
Báo cáo khoa học: ˚ cDNA cloning and 1.75 A crystal structure determination of PPL2, an endochitinase and N-acetylglucosaminebinding hemagglutinin from Parkia platycephala seeds potx

Báo cáo khoa học: ˚ cDNA cloning and 1.75 A crystal structure determination of PPL2, an endochitinase and N-acetylglucosaminebinding hemagglutinin from Parkia platycephala seeds potx

... analysis of the aggregation state of PPL2 employing 3964 Table Amino acid composition [molÆ(mol protein))1] of PPL2 Asx, aspartic acid and asparagine; Glx, glutamic acid and glutamine Amino acid ... NSH Þ=2 ð3Þ Amino acid analysis and N-terminal amino acid sequence determination Amino acid analysis was performed on a Pico-Tag amino acid analyzer (Waters) as described [49] One nanomole of ... galactose, N-acetylglucosamine, N-acetylgalactosamine, fucose) and glycoproteins (bovine thyroglobulin, ovine submaxillary mucin, bovine fetuin, and asialofetuin) were tested for hemagglutination inhibitory...

Ngày tải lên: 16/03/2014, 13:20

13 488 0
santiago as a hemmingway code hero in the old man and the sea

santiago as a hemmingway code hero in the old man and the sea

... the town about it, he just went home and fell asleep Landing the fish did not matter to the old man only to get it as far as the side of the boat The Old Man And The Sea portrays Hemingway Code ... potential As Heros they try their hardest to persevere under pressure and achieve the goal in front of them They show the characteristics of a stoic, working hard in the hardest of situations Hemingway ... fishes to be a fisherman His goal was not to catch a huge fish It was to fish and try to catch a fish of any size He did not pride himself on catching the fish He did not go running to tell the...

Ngày tải lên: 21/03/2014, 22:50

2 922 1
Health Expenditures and the Elderly: A Survey of Issues in Forecasting, Methods Used, and Relevance for Developing Countries doc

Health Expenditures and the Elderly: A Survey of Issues in Forecasting, Methods Used, and Relevance for Developing Countries doc

... medical care spending: Standard and non-standard effects.” Working Paper #6866 Cambridge, MA: National Bureau of Economic Research Dang, Thai Than, Pablo Antolin, and Howard Oxley 2001 “Fiscal ... (Ainsworth and Dayton 2001; Barnett and Blaikie 1992; Vanlandingham et al 2000, WHO (World Health Organization) 2001) In a study of Tanzania, Ainsworth and Dayton (2001) found a short-term impact on ... create a large body of information in developing countries related to health care spending, social transformations, disability and mortality patterns and the like Assuming the data were available,...

Ngày tải lên: 22/03/2014, 13:20

44 652 0
Industrial Hemp (Cannabis sativa L.) as a Papermaking Raw Material in Minnesota: Technical, Economic, and Environmental Considerations ppt

Industrial Hemp (Cannabis sativa L.) as a Papermaking Raw Material in Minnesota: Technical, Economic, and Environmental Considerations ppt

... as bagasse (or sugarcane residue), have long been used in making paper in China, India, Pakistan, Mexico, Brazil and a number of other countries (Pande 1998) Today, production of paper and paperboard ... Groot et al (1999) have extensively evaluated bast fiber as a papermaking raw material using a variety of pulping methods Their findings indicate that industrial hemp bast fiber has a wide range ... source of papermaking fiber For example, paper was invented in China in A. D 105, but it was not until about 1850 that wood began to be used as a principal raw material for papermaking Early sources...

Ngày tải lên: 24/03/2014, 05:20

47 421 0
Báo cáo hóa học: " MMP-1 is a (pre-)invasive factor in Barrettassociated esophageal adenocarcinomas and is associated with positive lymph node status" doc

Báo cáo hóa học: " MMP-1 is a (pre-)invasive factor in Barrettassociated esophageal adenocarcinomas and is associated with positive lymph node status" doc

... Takeo S, Harada T, Okazawa T, Yanai H, Okita K: Matrix metalloproteinase-7 and matrix metalloproteinase-9 are associated with unfavourable prognosis in superficial oesophageal cancer Br J Cancer ... in a major population of proliferating MMP-1+ Barrett and EAC cells Expression of MMP-1 in proliferating (Ki-67+) cells of intestinal metaplasia and in Barrett-associated adenocarcinomas may ... been available regarding clinicopathological factors in BE and EAC so far Our findings of an increased MMP-1 expression in EAC is well in line with results obtained in other cancer entities and...

Ngày tải lên: 18/06/2014, 16:20

11 648 0
Báo cáo hóa học: "Editorial Frames and Overcomplete Representations in Signal Processing, Communications, and Information Theory" pptx

Báo cáo hóa học: "Editorial Frames and Overcomplete Representations in Signal Processing, Communications, and Information Theory" pptx

... Electronics at MIT Her current research interests are in the general areas of signal processing, statistical signal processing, and quantum information theory Dr Eldar was in the program for outstanding ... next article by F Jin et al proposes a new denoising method in which motion estimation and compensation, as well as temporal and spatial filtering, are all done in the wavelet domain Another interesting ... Leaders in Science and Technology program at the Technion and an Alon Fellow In 2004, she was awarded the Wolf Foundation Krill Prize for Excellence in Research, and in 2005 the Andre and Bella...

Ngày tải lên: 22/06/2014, 23:20

2 275 0
Báo cáo y học: "Cartilage oligomeric matrix protein is involved in human limb development and in the pathogenesis of osteoarthriti" pptx

Báo cáo y học: "Cartilage oligomeric matrix protein is involved in human limb development and in the pathogenesis of osteoarthriti" pptx

... 0.3 µm in (a) and (b) and 0.25 µm in (c) and inset (a) n, nucleus with a macroscopically normal appearance in OA cartilage and vice versa: a few type cells are also present in the area adjacent ... oarthritic cartilage taken from the area adjacent to the main defect, (b) clear bands at 105 kDa for cartilage oligomeric protein (COMP) (arrow) and a fainter band at 160 kDa in the same extract, ... µm in (c) and insets (a) and (b) ure 2, lane 2) The 105 kDa band for a monomer was seen in both extracts, whereas a second band was found only in the OA cartilage sample and might represent a...

Ngày tải lên: 09/08/2014, 07:20

10 481 0
Strategic corporate governance, employment risk, and firm risk taking a three essay investigation in the u s  and taiwan

Strategic corporate governance, employment risk, and firm risk taking a three essay investigation in the u s and taiwan

... Risk Taking Shuping Li 2014   We obtained financial information from Compustat’s North America and Global annual databases Compustat Global normalizes firm fundamentals and market information ... spot internal inconsistencies in managerial decisions and activities As a result, monitors are more confident in using codified criteria in making evaluation and attribution decisions Third, increased ... criteria to increasingly emphasize evaluation and attribution based on codified information, because it is easier to access such data than to access tacit information Second, increased reliability and...

Ngày tải lên: 09/09/2015, 11:28

170 261 0
Genes involved in colon cancer development and progression

Genes involved in colon cancer development and progression

... 5’-gaatggcgaagtaaatgc-3’ HPRT1 5’tgacactggcaaaacaatgca3’ 5’ggtccttttcaccagcaagct3’ 18S rRNA 5’-gtaacccgttgaaccccatt-3’ 5’-ccatccaatcggtagtagcg-3’ Palladin 5’-tggtgcgtgagaacgg-3’ 5’-cccaatacacgacattcc-3’ ... Integrins act as a relay machine by transmitting extracellular signals into activation of intracellular signaling processes Integrins are able to bind to many ECM molecules, causing the activation ... remaining 15% of colon cancer cases not involve APC mutation and are often found to have activating mutation in β-catenin These cases are also accompanied with mutations in the mismatch-repair...

Ngày tải lên: 07/10/2015, 10:02

80 116 0
Aging and decision making: a comparison between neurologically healthy elderly and young individuals ppt

Aging and decision making: a comparison between neurologically healthy elderly and young individuals ppt

... hypothetical and the last was the actual round A pen and a picture frame were used in the hypothetical situations, and a coffee mug was used for the actual situation Only the actual round had a real payoff, ... losses and gains that might be exacerbated by age Finally, both younger and older subjects participated in beauty contest games, in which strategic thinking plays a central role In each case, the ... neuroscience literature the choice of deck A is treated as a mistake Bechara et al conducted their gambling task with a population of healthy adults and a population of individuals with damage to the...

Ngày tải lên: 22/03/2014, 14:20

16 598 0
guilt by descent moral inheritance and decision making in greek tragedy dec 2007

guilt by descent moral inheritance and decision making in greek tragedy dec 2007

... character in extant tragedy presents a more acute case of the mortal agent standing at the interface between supernatural causation and human action, where causal determinants of various kinds ... certain constellation of causal determinants that operate in the corrupted and inward-looking oikoi of tragedy, paying particular attention to the Atreids and the Labdacids Chapters 2, 3, and ... Delhi Shanghai Taipei Toronto With oYces in Argentina Austria Brazil Chile Czech Republic France Greece Guatemala Hungary Italy Japan Poland Portugal Singapore South Korea Switzerland Thailand Turkey...

Ngày tải lên: 10/06/2014, 22:19

217 332 0
Representation and Decision-Making in Environment Planning with Emphasis on Energy Technologies doc

Representation and Decision-Making in Environment Planning with Emphasis on Energy Technologies doc

... Australian Mining Australians Against Uranium Expansion http://www.miningaustralia.com.au/Article/Australiansagainst-uranium-expansion/430463.aspx 140 A fourth operation, the Honeymoon mine in ... Thailand’s total land area amounts to 513,120 km2, and it shares boundaries with Myanmar in the West and Northwest, Lao PDR in the East and Northeast, Cambodia in the Southeast and Malaysia in the South ... geographical regions constituting Thailand are: • Northern Thailand; • Northeastern Thailand; • Western Thailand; • Central Thailand; • Eastern Thailand; and • Southern Thailand The estimated...

Ngày tải lên: 29/06/2014, 02:20

126 302 0
Analysis and applications of the km algorithm in type 2 fuzzy logic control and decision making

Analysis and applications of the km algorithm in type 2 fuzzy logic control and decision making

... decision making processes For example, Wu and Mendel applied the linguistics weighted average to a hierarchical decision making for evaluating a weapon system [86] In this hierarchical decision making ... performance of competing alternatives are evaluated by comparing the aggregation of hierarchical criteria and sub-criteria of alternatives The linguistic weighted average was also applied for evaluating ... optimize the initialization, termination and computation are as follows: Initialization: The initialization of the KM iterative algorithm is inefficient and thus may cause a large number of iterations...

Ngày tải lên: 09/09/2015, 18:49

206 344 0
w