a hallway with a climate control system

... Haptic Audio Visual Environments and their Applications, 2005, pp 109-114 [8] S.M.A Haque, S.M Kamruzzaman, and M.A Islam, A system for smart home control of appliances based on timer and speech ... RGB-D camera (e.g., Microsoft Kinect sensor [1]) By using both depth and RGB data, we can extract hand regions from background more accurately We then analyze spatial features of hand shapes and ... operations controlling home appliances This easy-to-use system allows user interact naturally without any contact with mechanical devices or GUI interfaces The proposed system not only maximizes

Ngày tải lên: 12/02/2020, 15:38

... risk of a potential disaster is analyzed by CEMADEN team at a crisis room Technically, an alert system using CEMADEN data is in fact a FAS with additional landslide signals [24] for Page of 14 ... Brazil, given the continental size and the variety of socio-economic contexts Abbreviations AD, analog-digital; ADS, Alert Dissemination System; ANA, Agência Nacional de Águas (National Water Agency); ... the Brazilian government established a national plan (named National Plan for Risk Management and Disaster Response) and created the Brazilian Center for National Disaster Monitoring and Alerts

Ngày tải lên: 04/12/2022, 16:06

... of our model at hand Indeed, we are dealing with a dynamical system with piecewise constant nonlinearlities see e.g., 2–6 , and the usual linear and continuity arguments cannot be applied to our ... threshold as a bifurcation parameter that varies between and ∞, we work out a complete asymptotic and bifurcation analysis Among other things, we show that all solutions either tend to a limit ... Equation with Piecewise Constant Control Chengmin Hou,1 Lili Han,1 and Sui Sun Cheng2 Department of Mathematics, Yanbian University, Yanji 133002, China Department of Mathematics, Tsing Hua University,

Ngày tải lên: 21/06/2014, 11:20

... nonlinear parabolic equations with nonlocal boundary condition,” Journal of Mathematical Analysis... 2007 29 L Kong and M Wang, “Global existence and blow-up of solutions to a parabolic ... Nonlinear Analysis: Theory, Methods & Applications, vol 39, no 3, pp 327–340, 2000 12 V A Galaktionov, S P Kurdyumov, and A A Samarski˘, A parabolic system of quasilinear ı equations ... vol 2007, Article ID 64579, 12 pages, 2007 32 H.-M Yin, “On a class of parabolic equations with nonlocal boundary conditions,” Journal of Mathematical Analysis and Applications, vol

Ngày tải lên: 21/06/2014, 11:20

... reaction-diffusion equations,” Archive for Rational Mechanics and Analysis, vol 129, no 1, pp 47–100, 1995 J.-S Guo, S Sasayama, and C.-J Wang, “Blowup rate estimate for a system of semilinear ... 2, Ω ⊂ Rn is a bounded domain with smooth boundary, the initial data u0 and v0 are positive, smooth, and compatible with the boundary data Because of the singular nonlinearity inner absorption ... North-Holland, Amsterdam, The Netherlands, 1978 17 R Ferreira, “Numerical quenching for the semilinear heat equation with a singular absorption,” Journal of Computational and Applied Mathematics, vol 228,

Ngày tải lên: 21/06/2014, 16:20

... Problems, vol 2007, Article ID 64579, 12 pages, 2007 20 H.-M Yin, “On a class of parabolic equations with nonlocal boundary conditions,” Journal of Mathematical Analysis and Applications, vol 294, ... for parabolic systems,” Zeitschrift fur Angewandte Mathematik und Physik, vol ă 47, no 1, pp 132143, 1996 M Escobedo and M A Herrero, “A semilinear parabolic system in a bounded domain,” Annali ... that there is no work dealing with singularity analysis of the parabolic system 1.1 with nonlocal boundary condition 1.2 except for the single equation case, although this is a very classical

Ngày tải lên: 21/06/2014, 20:20

... Palmas de Gran Canaria, Spain 4 Servicio de Inmunologia, Hospital Universitario de Gran Canaria Doctor Negrin, Barranco de la Ballena s/n, 35010 Las Palmas de Gran Canaria, Spain Corresponding author: ... Sanchez4, Ayoze Garcia-Saavedra4, Maria Jesus Citores2, Juan A Vargas2 and Paloma Perez-Aciego1 1 Fundacion LAIR, Madrid, Spain 2 Servicio de Medicina Interna I, Hospital Universitario Puerta de Hierro, ... patients with RA Materials and methods Patients and controls The study used a case-control design to compare patients and controls A total of 189 patients diagnosed with RA according to the American

Ngày tải lên: 09/08/2014, 10:21

... acknowledge the clinical assistance of Dr Elham Bayat and Dr Venkata Erella, and the statistical assistance of Dr James Malley, Dr Karen Malley, and Dr Robert Wesley. They thank Dr Sahar Dawisha, ... a conventional manual immun- ofixation electrophoresis method involving the use of Paragon Blue stain (Paragon; Beckman-Coulter, Brea, CA, USA). Statistical analyses Data are shown as the mean ... implants and paraproteinemia probably had implant rupture (Table 2). While the women with silicone implants and paraproteinemia (Table 2) were older than those women with paraproteinemia without

Ngày tải lên: 09/08/2014, 10:21

... MICA-210: CCTTTTTTTCAGGGAAAGTGC, CCTTACCATCTCCAGAAACTGC [22], and bioCCATGTTTCTGCTG(L)TGCTGCT; MICA-300: GGAAGGCTGTGCAGTAATCTAGG, TCCCTTTTCCAGCCTGCC, and bioCTGTGCAGT(L)ATCTAGGCTGAAGG; and MICA-250: ... MICA-250: AAGGTGATGGGTTCGGGAA, TCTAGCAGAATTGGAGGGAG [21], and bioCTCAGGAC(L)ACGCCGGATT For the MICA250 assay, a genotyping primer bioCTCCAGAG [L]TCAGACCTTGGC, differentiating between a paralogue ... Table Case-control analysis in German Caucasians (a) All individuals without controlling for LD with HLA-DRB1 Minor allele Allele frequency in cases/controls Total alleles of RA cases/controls

Ngày tải lên: 09/08/2014, 14:20

... inflammatory response during cardiopulmonary bypass: a randomized study Interact Cardiovasc Thorac Surg 2009, 8:93-99 34 Sakagawa H, Miyazaki T, Fujihara M, Sato S, Yamaguchi M, Fukai K, Morioka ... P value was below 0.01 Conclusions We have shown that transfusion is associated with pulmonary and systemic inflammation as well as with activation of coagulation and impaired fibrinolysis, an ... Transfusion was also associated with systemic derangement of coagulation and, to a lesser extent, systemic inflammation • The amount of transfusion is associated with longer mechanical ventilation

Ngày tải lên: 14/08/2014, 07:21

... 116:1002-1010. 13. Abeyama K, Stern DM, Ito Y, Kawahara K, Yoshimoto Y, Tanaka M, Uchimura T, Ida N, Yamazaki Y, Yamada S, Yamamoto Y, Yamamoto H, Iino S, Taniguchi N, Maruyama I: The N-terminal domain of ... Shimazaki S, Yamamoto Y, Aikawa N, Ohno R, Hirayama A, Matsuda T, Asakura H, Nakashima M, Aoki N: Efficacy and safety of recombinant human soluble thrombomodulin (ART-123) in disseminated intravascular ... 9 of 10 participated in data interpretation. HO had a major impact on the interpretation of data and critical appraisal of the manuscript. THamasaki performed the statistical analysis and helped

Ngày tải lên: 14/08/2014, 08:21

... I have the pleasure of working with, namely: Antia Lamas-Linares, Alexander Ling, Ivan Marcikic, Valerio Scarani, Alexander Zhukov, Liang Yeong Cherng, Poh Hou Shun, Ng Tien Tjuen, Patrick Mai, ... Bohr radius aexc (aexc = 5.6 nm for CdSe) If the mean nanocrystal radius a is greater than ¯ 3aexc... in a transparent polymer sandwiched between a fused silica cover slip and a glass ... Kurucz, R. L. Amp tools: Databases: Kurucz atomic line database. URL http://www.cfa.harvard.edu/amp/ampdata/kurucz23/sekur.html. Accessed on Mar 2009. [162] Ben G. Streetman, S. B. Solid State Electronic

Ngày tải lên: 11/09/2015, 09:06

... method was validated with real ambient vibration data from a steel mast excited by wind load (Peeters and De Roeck, 1999) A subspace approach with an instrumental variable concept (Huang and ... (16.7%) at level 4 and small damage (4.1%) damage at level 6 186 6.12 Damage case D4 (4L3S6S) with complete measurement: large damage (16.7%) at level 4 and small damage (4.1%) at levels 3 and ... Structural Change via Experimental Data 269 270 Appendix B Identification of Structural Change via Experimental Data Table B.60: D6-“T-Sub” identification: 17% damage at levels 3, and via complete

Ngày tải lên: 14/09/2015, 08:46

... being displaced, would leave gate marks and mean a large percentage of wasted material in the runner Internal gating would be a possibility with a threeplate mold and a break-away pinpoint gate However, ... in a bore of the manifold plate (4) The “frozen” material layer d acts as heat insulation, so that the manifold plate (4) is allowed to make h l l surface contact with the two adjacent mold plates ... cartridge heaters (19) are incorporated, each with a heating capacity of 800 W (Fig 3) On the outside of the mold there are clamps (20) that pull the cavity plates (4a) and (4b) as well as (5a) and (5b)

Ngày tải lên: 29/04/2016, 13:51

... distance map Figure B.4: Wheelchair control system based on freespace values and camera calibration The wheelchair control system was computed based on the Z-X coordinates of 2D distance map as shown ... DIGICLOPS_ALREADY_STARTED, // Device already initialized // Grabbing has already been started DIGICLOPS_CALLBACK_NOT_REGISTERED, // Callback is not registered DIGICLOPS_CALLBACK_ALREADY_REGISTERED, ... image point R - Rotation matrix T - Translation vector u1:t - Past controls of freespace uauto(va,ωa) - Autonomous mode ud1:t - All past controls in estimating dynamic freespaces

Ngày tải lên: 20/05/2016, 15:28

... a 16-bit value data type, therefore the pointer will be a 16-bit value ARRAYS: An array is a data set of a declared type, arranged in order An array is declared with the array ... MULTIDIMENSIONAL ARRAYS: a multidimensional array... The CAN channel controls the communication parameters of CAN Controller with physical bus via the PCA82C250 The MObs are responsible to handle all ... manipulate the parallel misalignment And the last thing, if the DC-motor parameter such as voltage and torque constant can be calculated, the experiment time could be reduced dramatically With all

Ngày tải lên: 23/09/2016, 16:09

... Forest and Climate Change, The Federal Democratic Republic of Ethiopia, Oromia Forested Landscape Program Environmental and Social Management Framework (ESMF) (Updated) (Addis Ababa, Feb 2017), available ... father of climate change awareness, calls Paris talks 'a fraud , The Guardian (London, England), (12/12/ 2015), last seen on 02/03/2017 Paris climate deal: What the agreement means for India and ... significant action in addressing climate change.2 The UNFCCC is an international environmental treaty (also known as a multilateral environmental agreement) that was opened for signature at the Earth

Ngày tải lên: 14/08/2017, 16:47

... about / How to prepare your current home for a security system USB cameras demonstration / Camera and IP Camera V version control about / Version control and Git virtualenv about / Installing the application and its dependencies ... IP Camera about / Camera and IP Camera J Joule’s law about / Joule’s law URL / Joule’s law L library creating / Making your own library Linux system Arduino IDE, installing on / GNU-Linux (Debian-Ubuntu) ... Summary Getting Started with Arduino and Arduino IDE Arduino boards Arduino MEGA Arduino NANO Arduino ETHERNET Intel GALILEO Arduino UNO Safety precautions Arduino IDE Installation Installing IDE on Microsoft Windows

Ngày tải lên: 05/11/2019, 11:17

... than one bit per baud Baseband and broadband The principle characteristics of base-band and broadband systems are listed in Table BASEBAND Digital signalling Entire bandwidth consumed By signal ... COMMUNICATIONS IN A PROCESS CONTROL SYSTEM by GR MacKenzie, AEG Communication has become a major part of any process control automation system Today PLC communication is as much for data acquisition ... in automation systems today, have at least one PS232 (serial) interface as a standard RS232, however, has some limitations Distance, a maximum of 50 ft by definition (without modems) is a major...

Ngày tải lên: 25/12/2013, 08:50

... distribution with optional seat heating and active seat ventilation 22 E70 Climate Control Systems FKA Rear Automatic Air Conditioning (IHKA and FKA, 4-zone) Index Explanation FKA rear automatic air conditioning ... defrost air outlet 10 Ventilation air outlet, rear left/right E70 Climate Control Systems IHKA 4-zone with FKA rear automatic A/ C System Index Explanation IHKA with rear automatic air conditioning system, ... bulkhead 28 E70 Climate Control Systems Air Flap Control Actuator The IHKA actuator motors are all designed as identical components and are actuated by the IHKA via the LIN bus When an actuator motor...

Ngày tải lên: 19/10/2012, 13:50