a general approach to identify novel viral genes

báo cáo khoa học: "A microarray approach to identify genes involved in seed-pericarp cross-talk and development in peach" ppt

báo cáo khoa học: "A microarray approach to identify genes involved in seed-pericarp cross-talk and development in peach" ppt

... Maruyama-Nakashita A, Nakabayashi K, Li W, Ogawa M, Yamauchi Y, Preston J, Aoki K, Kiba T, Takatsuto S, Fujioka S, Asami T, Nakano T, Kato H, Mizuno T, Sakakibara H, Yamaguchi S, Nambara E, Kamiya ... selected genes are listed in Additional file Oligonucleotides PpN1for (CCAGGAGAATC GGTGAGCAGAAAA) and PpN1rev (TCGAGGGTGGAGGACTTGAGAATG) annealing to the peach putative transcript ppa009483 m, ... Kamiya Y, Takahashi H, Hirai MY, Sakurai T, Shinozaki K, Saito K, Yoshida S, Shimada Y: The AtGenExpress hormone and chemical treatment data set: experimental design, data evaluation, model data analysis...

Ngày tải lên: 11/08/2014, 11:21

14 208 0
Báo cáo y học: "A genome-wide approach to identify genetic loci with a signature of natural selection in the Irish population" pps

Báo cáo y học: "A genome-wide approach to identify genetic loci with a signature of natural selection in the Irish population" pps

... tend to be skewed towards negative values and this can be attributed to population expansion that occurred to humans post migration from Africa [17] In an early genome-level analysis, analyzed ... Branch lengths (lEU, lAF, lAS) were calculated from single locus pairwise FST distances lEU = (European:Asian FST + European-African FST - Asian-African FST)/2; lAS = (European-Asian FST + Asian-African ... Asian-African FST - European-African FST)/2; lAF = (European-African FST + Asian-African FST - European-Asian FST)/2 deposited research Statistical tests to identify the signature of selection African...

Ngày tải lên: 14/08/2014, 17:22

9 460 0
A chemical genetics approach to identify targets essential for the viability of mycobacteria

A chemical genetics approach to identify targets essential for the viability of mycobacteria

... family and friends (especially those that took the time to visit me from Germany, New Zealand, Hong Kong and Malaysia) – i.e Kenny, Matthias, Claudia, Shannon, Joanna, Janice, Tania, Jo-Ann and ... 5'-CCGGTTTCATCCCCGATCCGGA-3' pMV261.rv 5'-CGTACGCTAGTTAACTACGTCG-3' pYUB415.fw 5'-GATAAGCGGTCAAACATGAG-3' pYUB415.rv 5'-TGCCACCTGACGTCTAAGAA-3' Expression Construct H37Rv CorA Exp.fw 5'-TTGGCCTCCAGCAGGTCACT-3' ... microarray approach is to spot a collection of plasmidbased vectors expressing different cDNAs and cover it with a layer of mammalian cells and transfection reagent This would create an array of...

Ngày tải lên: 15/09/2015, 22:51

109 260 0
A novel role of hydrogen sulfide in wound healing and a new approach to wound dressing in rat model

A novel role of hydrogen sulfide in wound healing and a new approach to wound dressing in rat model

... Materials and Methods Statistical analysis Data are presented as mean ± SE Statistical significance was analyzed by variance (ANOVA), a Tukey test was applied when necessary for comparisons A value ... mediator, implicated in the pathogenesis of diseases as diverse as hypertension, asthma, septic shock and dementia; and as a potential marker of clinical diseases, that may prove amenable to therapeutic ... so as to calculate the total wound area (i.e L x B) A mathematic model was applied to determine the time to half wound healing In the exponential phase starting from Day 3, the change in area...

Ngày tải lên: 26/09/2015, 09:39

80 432 0
Báo cáo khoa học: "Veterinary decision making in relation to metritis - a qualitative approach to understand the background for variation and bias in veterinary medical records"

Báo cáo khoa học: "Veterinary decision making in relation to metritis - a qualitative approach to understand the background for variation and bias in veterinary medical records"

... able to create meaningful data valid in large scale analyses (across herds and veterinary practices) Such veterinarians would generally want to focus on possibilities for across-herd data analyses ... scores as a 'diagnostic tool' related to each individual treatment decision rather than being part of a collaborative data collection For example, they could add rectal temperature and other parameters ... Page of 10 (page number not for citation purposes) Acta Veterinaria Scandinavica 2009, 51:36 cal analyses in the future, and they are highly motivated to use, for instance, multi-factorial analysis...

Ngày tải lên: 25/10/2012, 10:45

10 589 0
Báo cáo y học: " A Practical Approach to Managing Patients with HCV Infection"

Báo cáo y học: " A Practical Approach to Managing Patients with HCV Infection"

... correlates poorly with liver histology, the ratio of aspartate aminotransferase (AST) to alanine aminotransferase (ALT) >1 is a dependable marker for cirrhosis [28,29] Increased INR and thrombocytopenia ... pathogenesis of thrombocytopenia in patients with chronic viral hepatitis Br J Haematol 2001;113(3):590-5 31 Harisinghani MG, Hahn PF Computed tomography and magnetic resonance imaging evaluation ... HCC, and mortality In addition, HCV infection has been linked to a variety of extra-hepatic manifestations such as autoimmune diseases, lymphoma, monoclonal gammopathies and cryoglobulinemia Some...

Ngày tải lên: 02/11/2012, 09:51

6 534 0
Báo cáo y học: "A Practical Approach to Management of Chronic Hepatitis B"

Báo cáo y học: "A Practical Approach to Management of Chronic Hepatitis B"

... years, ALT has been used as a standard surrogate for the activity of CHB Thus, ALT level in combination with HBV DNA level and histological activity has been used as a determinant for HBV treatment ... normal transaminases have historically not been considered as candidates for HBV treatment based on the assumption that these patients usually have a slow progression and evidence that these patients ... predictors of response to LAM and ADV therapies are similar to those for IFN except that baseline HBV DNA may not be very important Individualization of HBV Treatment As summarized in Table and...

Ngày tải lên: 03/11/2012, 09:41

7 543 0
A New Approach to Quantum Theory

A New Approach to Quantum Theory

... However, Feynman soon learned that there was a great obstacle to this delayed action-at -a- distance theory: namely, if a radiating electron, say in an atom or an antenna, were not acted upon at all by ... xn (a) and which leaves the action invariant (for example, the transformation may be a rotation) The transformation is to contain a parameter, a, and is to be a continuous function of a For a equal ... gives probably the most fundacorresponds to e mental quantum analogue for the classical Lagrangian function It is preferable for the sake of analogy to consider the classical Lagrangian as a function...

Ngày tải lên: 06/11/2012, 11:21

142 577 0
A General Introduction to Hegel_s system

A General Introduction to Hegel_s system

... world of passion and pain.13 For God’s exaltation above man did not affect man’s ability to know him; it was a moral and metaphysical exaltation, not an elevation beyond the range of man’s knowledge; ... same fundamental notion, it was for every reason natural that what had so long been a familiar truth and obvious certitude, should come to be regarded by Hegel as a dogma as indubitable as to ... that at the outset this position was rather a dogmatic assumption, or at least a mere intuition, and not a principle arrived at after a process of preliminary critical inquiry And indeed even to...

Ngày tải lên: 06/11/2012, 15:51

252 521 0
A new approach to semantic and syntactic functions of English adjectives – A contrastive analysis with their Vietnamese equivalents

A new approach to semantic and syntactic functions of English adjectives – A contrastive analysis with their Vietnamese equivalents

... time available/ in the available time.(1) We have to exploit all available potential/ all potential available in our country (2) As we know that when changing the position of adjective available ... should be washed everyday Nguyễn Thị Nga K 1 1A 19 Graduation paper 2.2.5 Exclamatory adjective sentence An adjective as head of an adjective phrase or as its sole realization can be an exclamation: ... up to now C .A plays an important role in learning a foreign language as a main subject at most language universals According to C James (1980;19), C .A is a form of inter-language study and a central...

Ngày tải lên: 10/04/2013, 14:46

44 1,8K 9
Listening to Patients A Phenomenological Approach to Nursing Research and Practice

Listening to Patients A Phenomenological Approach to Nursing Research and Practice

... however, identify the man as a nurse and Ginger as a physician, whereas still other reactions identify the man as a nurse and Ginger as a patient You don't have to be a philosopher of language or a ... Library of Congress Cataloging-in-Publkation Data Thomas, Sandra P, Listening to patients : a phenomenological approach to nursing / Sandra P Thomas, Howard R Pollio p cm Includes bibliographical ... the American Nurses Association, the American Psychological Association, and Sigma Theta Tau International She is a board member of the International Council on Women's Health Issues and a charter...

Ngày tải lên: 16/10/2013, 11:15

309 401 0
Managing and Practicing OD in an IT Environment - A Structured Approach to Developing IT Project Teams

Managing and Practicing OD in an IT Environment - A Structured Approach to Developing IT Project Teams

... team The database analysts and the programmers are unable to agree on the proper ways to pass information back and forth between the interface and the database, and the requirements analysts and ... software packages), hardware and software implementation (implementing new computers or software), database management and revision (ensuring proper data storage and access), hardware and software ... Project managers usually employ a Responsibility Assignment Matrix (RAM) such as the sample in Table (PMI, 2000), and OD scholars have advocated similar approaches in teambuilding and organizational...

Ngày tải lên: 24/10/2013, 08:20

33 570 0
College writing - A personal approach to academic writing

College writing - A personal approach to academic writing

... into manageable size—say to make a presentation about the Vietnam War or locate the best marketing strategy for a hypothetical business venture—consider making a quick visual map to see what ... number of audiences equals the number of students in class Write one per slip of paper and place in a hat and let each student draw an audience out of a hat Each now write a paragraph to the audience ... draft is ready to share I don’t want someone to see a draft too early because I already know how I am going to continue to fix it; other times, when I am far along in the process, I don’t want a...

Ngày tải lên: 18/12/2013, 17:33

253 498 0
Tài liệu The New Face oF GoverNmeNT: How Public Managers Are Forging a New Approach to Governance pdf

Tài liệu The New Face oF GoverNmeNT: How Public Managers Are Forging a New Approach to Governance pdf

... the Sandia National Laboratory study on enterprise transformation serves to bring the dangers that managers and administrators face when attempting to impose a transformational change into their ... Sandia National Laboratories approach, a four-level transformation model that focuses on identifying a transformation trigger, and an eight-factor public management model A Need for Transformation ... the earlier actions are integrated into the organization’s culture The Sandia Laboratories management team, for example, warned that a transformation initiative should not demand more than the...

Ngày tải lên: 15/02/2014, 20:20

288 2,4K 0
Tài liệu A Strategic Approach to Cost Reduction in Banking - Achieving High Performance in Uncertain Times docx

Tài liệu A Strategic Approach to Cost Reduction in Banking - Achieving High Performance in Uncertain Times docx

... competitive advantage over its rival and is on the path to high performance The key is for banks to evaluate their business model now against scenarios ranging from best case to worst case, and to act ... program initiatives1 As Figure shows, a tactical cost-cutting approach will quickly yield substantial savings which rapidly level off after the first year A bank taking a more strategic, transformational ... Accenture’s approach to efficiency contains a portfolio of tools and assets—the Accenture High Performance Bank Framework—that can help a bank achieve high performance We believe there are significant...

Ngày tải lên: 16/02/2014, 11:20

16 514 0
Tài liệu CHAPTER TwENTY ONE A BIOLOGICAL APPROACH TO A MODEL OF AESTHETIC ExPERIENCE OSHIN VARTANIAN AND MARcos NADAL pdf

Tài liệu CHAPTER TwENTY ONE A BIOLOGICAL APPROACH TO A MODEL OF AESTHETIC ExPERIENCE OSHIN VARTANIAN AND MARcos NADAL pdf

... contrast, the studies by Kawabata and Zeki (2004) and Skov ef al (2005) attempted to isolate those cortical structures that are actIvated more when a stimulus is evaluated as beautiful Presumably, ... network than before, again including the occipital, temporal, and the frontal lobes, but in particular bilateral orbital frontal corlex What the results of Kawabata and Zeki (2004) and Skov ef al (2005) ... neural correlates of preference and beauty, two variables that have affective and cognitive components The areas activated by Vartanian and Goel (2004b) may have highlighted those cOrlical structures...

Ngày tải lên: 19/02/2014, 17:20

9 602 0
Tài liệu Báo cáo khoa học: "A Bootstrapping Approach to Named Entity Classification Using Successive Learners" pdf

Tài liệu Báo cáo khoa học: "A Bootstrapping Approach to Named Entity Classification Using Successive Learners" pdf

... unlimited raw corpus compensates for the modest recall As a result, large quantities of NE instances are automatically acquired An automatically annotated NE corpus can then be constructed by extracting ... fourDigitNum, containsDigitAndAlpha, containsDigitAndDash, containsDigitAndSlash, containsDigitAndComma, containsDigitAndPeriod, otherNum, allCaps, capPeriod, initCap, lowerCase, other Benchmarking and Discussion ... example: IsA(man) Æ PER IsA(city) Æ LOC IsA(company) Æ ORG IsA(software) Æ PRO Automatic Construction of Annotated NE Corpus In this step, we use the parsing-based first learner to tag a raw...

Ngày tải lên: 20/02/2014, 16:20

8 491 0
Tài liệu A structured approach to Enterprise Risk Management (ERM) and the requirements of ISO 31000 ppt

Tài liệu A structured approach to Enterprise Risk Management (ERM) and the requirements of ISO 31000 ppt

... identify critical components that are key to success G HAZOP and FMEA approaches Hazard and Operability studies and Failure Modes Effects Analysis are quantitative technical failure analysis techniques ... they enable an organisation to identify accumulations of similar risks A risk classification system will also enable an organisation to identify which strategies, tactics and operations are most ... N 17 Risk appetite, tolerance and constraints Sources of assurance available to the Board A structured approach to Enterprise Risk Management Appendix B: Implementation summar y The table below...

Ngày tải lên: 21/02/2014, 12:20

20 821 1
w