... of apoptosis Cancer Gene Ther 2010, 17:212-222 Morikawa T, Sugiyama A, Kume H, Ota S, Kashima T, Tomita K, Kitamura T, Kodama T, Fukayama M, Aburatani H: Identification of Toll-like receptor as ... physic-chemical properties (size and charge) of each separate material, including PCFC-g-PEI and FA-PEAs, as well as the FA-PEAs: pVHL complexes Because PCFC-g-PEI and FA-PEAs are amphiphilic ... cationic HPEI nanogel was conjugated by 2-kD PEI and heparin Heparin is a biodegradable negative polysaccharide with many carboxylic groups, and PEI is a cationic polymer with many primary amine...
Ngày tải lên: 18/06/2014, 19:20
... (1386-5': GAAACTATGCCAAAAACAAGT and 2129-5': TAATCTAGCCTTCTGTCCTGG) and two internal gag-specific primers (1731N 5': CCGTCAGGATCAGATATTGCAGGAA and 2042C 5': CACTAGCTTGCAATCTGGGTT), as previously ... days Evaluation of the transduction rate DNA was extracted from macaque PBMCs and the amount used for each sample was normalized based on data for amplification of the β-globin gene, using 5'ACCATGGTGCTGTCTCCTGC-3' ... salary from an organization that may in any way gain or lose financially from the publication of this paper in the past five years The authors never any stocks or shares in an organization that...
Ngày tải lên: 13/08/2014, 13:20
Báo cáo sinh học: "Gene therapy with tumor-specific promoter mediated suicide gene plus IL-12 gene enhanced tumor inhibition and prolonged host survival in a murine model of Lewis lung carcinoma" pptx
... cooperate with HRP/IAA gene therapy Another major focus of the present study was to evaluate whether suicide gene therapy plus immuno -gene therapy had any Page of 10 toxicity on the treated animals ... nick-end labeling; ALT: alanine transaminase; AST: aspartate aminotransferase; BUN: blood urea nitrogen; Cr: Creatinine Acknowledgements This work was supported by grants from the National Natural Science ... of LLC ANOVA analysis as appropriate Kaplan-Meier curves were compared using the log-rank test In all cases, P values less than 0.05 were considered statistically significant Analysis was performed...
Ngày tải lên: 18/06/2014, 19:20
GENE THERAPY DEVELOPMENTS AND FUTURE PERSPECTIVES potx
... Heralding a New Era in Gene Therapy 71 Maro Bujak, Ivana Ratkaj, Mirela Baus Loncar, Radan Spaventi and Sandra Kraljevic Pavelic Chapter MicroRNAs in Disease and Health: Diagnostic and Therapeutic ... Clinical Aspects of Gene Therapy in Myocardial Infarction 267 Saurabh Bharti, Ashok Kumar Sharma, Bhaskar Krishnamurthy and Dharamvir Singh Arya Chapter 13 Gene Therapy for Therapeutic Angiogenesis ... Simon Rajendran, Garrett Casey, Martina F Scallan, Patrick T Harrison, Gerald C O’Sullivan and Mark Tangney Part Potential Applications of Gene Therapy in Future 265 Chapter 12 Preclinical and Clinical...
Ngày tải lên: 28/06/2014, 05:20
Gene therapy with an improved doxycycline-regulated plasmid encoding a tumour necrosis factor-alpha inhibitor in experimental arthritis pot
... previously To facilitate cloning, the sense and anti-sense oligonucleotides of sequences GATCTTAAGCCATACCCGGGATCGGGATCCGACTTGG and TCGACCAAGTCGGATCCCGATCCCGGGTATGGCTTAA, respectively, containing restriction ... transcriptional activators: novel mutations yield expanded range and sensitivity Proc Natl Acad Sci USA 2000, 97:7963-7968 Salucci V, Scarito A, Aurisicchio L, Lamartina S, Nicolaus G, Giampaoli S, Gonzalez-Paz ... Hypnorm™ (Janssen Animal Health, Janssen Pharmaceuticals, Antwerp, Belgium) and were anaesthetised with halothane (Concord Pharmaceuticals Ltd, Horsham, West Sussex, UK) using Boyle's apparatus (British...
Ngày tải lên: 09/08/2014, 10:20
Báo cáo sinh học: "A dual function fusion protein of Herpes simplex virus type 1 thymidine kinase and firefly luciferase for noninvasive in vivo imaging of gene therapy in malignant glioma" ppsx
... experiments and enzymatic assays SJ and AS carried out the immunohistochemical studies NGR and AS designed the experiments and evaluated the data All authors have read and approved the manuscript Acknowledgements ... M, Puranen M, Hurskainen H, Tyynela K, Turunen M, Vanninen R, Lehtolainen P, Paljarvi L, Johansson R, Vapalahti M, Yla-Herttuala S: Thymidine kinase gene therapy for human malignant glioma, using ... 10:2325-2335 Rainov NG: A phase III clinical evaluation of herpes simplex virus type thymidine kinase and ganciclovir gene therapy as an adjuvant to surgical resection and radiation in adults with...
Ngày tải lên: 14/08/2014, 19:22
Báo cáo sinh học: "The use of retroviral vectors for gene therapy-what are the risks? A review of retroviral pathogenesis and its relevance to retroviral vector-mediated gene delivery" pptx
... administered to animals viral replication per se did not appear to have an overt pathogenetic affect, rather a T-cell lymphoma eventuated [62], presumably as a result of oncogene activation Although ... vectors is that of insertional mutagenesis and oncogene activation Insertional mutagenesis and oncogene activation As discussed above, oncogene activation can occur either by transcription from ... play Clinical trials are based on extensive preclinical experimentation and animal trials that take many years to complete Clearly, the particular vector system that has been used to develop a...
Ngày tải lên: 14/08/2014, 19:22
Báo cáo sinh học: "Silencing the epidermal growth factor receptor gene with RNAi may be developed as a potential therapy for non small cell lung cancer" pot
... Genetic Vaccines and Therapy 2005, 3:5 Background Lung cancer is a leading cause of cancer death in Australia and the world [1,2] There are two types of lung cancers, non small cell (NSCLC) and ... 5'GGAGCUGCCCAUGAGAAAUdTdT-3' and antisense 5'AUUUCUCAUG GGCAGCUCCdTdT-3' The unrelated nonspecific dsRNAs as control were designed as following: sense 5'-GAACUUCAGGGUCAGCUUG CCdTdT-3' and antisense 5'-GGCAAGCUGACCCUGAAGUUCdTdT3' ... Vaccines and Therapy 2005, 3:5 according to the recommendation of the manufacturer (Dharmacon Research, USA) [19] The following sequences were successfully made: siRNA-EGFR sense 5'GGAGCUGCCCAUGAGAAAUdTdT-3'...
Ngày tải lên: 14/08/2014, 19:22
Báo cáo sinh học: "Is gene therapy a good therapeutic approach for HIV-positive patients?" pot
... Morgan RA, Walker R, Carter CS, Natarajan V, Tavel JA, Bechtel C, Herpin B, Muul L, Zheng Z, Jagannatha S, Bunnell BA, Fellowes V, Metcalf JA, Stevens R, Baseler M, Leitman SF, Read EJ, Blaese ... for citation purposes) Genetic Vaccines and Therapy 2007, 5:5 hairpin to form an intracellular siRNA To date, small interfering RNAs have been used in vitro to target viral genes like tat and rev ... the target RNA forming a double-stranded RNA structure that either blocks translation or becomes a target for degradation in the cell Attractive targets for this type of therapy are gag and other...
Ngày tải lên: 14/08/2014, 19:22
Identification and characterization of IFI30 as a glioblastoma specific promoter for glioma gene therapy
... IFI30-HSVTk was then used for the generation of recombinant bacmid IFI30 F ClaBamHI: 5'- ACGTATCGATACTTGGATCCTGGGTACCCTAGAGAAATGA-3’ IFI30 R NotI: 5'- ACTTGCGGCCGCTGCCTGGGAAATAAG-3' 28 Step Conditions ... al., 2006) Having a large 130 kb genome, baculovirus AcMNPV has a large cloning capacity and can be used to transfer a large functional gene 17 or multiple genes Other advantages of baculovirus ... exogenous genes, called transgenes, into somatic cells of a patient to obtain a therapeutic effect Initially gene therapy was considered as an approach for treating hereditary diseases, but it's...
Ngày tải lên: 22/10/2015, 21:20
Intravesical tumor necrosis factor alpha gene therapy mediated by a novel liposome system in an orthotopic murine bladder cancer model
... is AJCC/UICC (Table 1.1) Traditionally, Ta and T1 papillary urothelial carcinoma are called superficial cancer and T2 and above are termed as muscle invasive cancer Table1.1: Pathological staging ... T, Esuvaranathan K Intravesical liposome-mediated tumor necrosis factor-α gene therapy in an orthotopic murine bladder cancer model, (Oral Presentation and Travel Grant Award), 6th Annual Meeting ... thanks and deepest appreciation to my supervisors: A/ P Kesavan Esuvaranathan and Dr Ratha Mahendran for their constant guidance, support and encouragement throughout this project and critical...
Ngày tải lên: 08/11/2015, 16:45
Báo cáo y học: "Comparison of osteogenic potentials of human rat BMP4 and BMP6 gene therapy using [E1-] and [E1-,E2b-] adenoviral vectors"
... electrophoretically separated in a 0.8% agarose gel; and transferred onto a nylon membrane The membranes were baked at 80°C for 30 and probed with the pAdEasy1 plasmid, BMP4 cDNA fragment, or BMP6 cDNA fragment, ... et al In vivo endochondral bone formation using a bone morphogenetic protein adenoviral vector Hum Gene Ther 1999;10:2245-53 Amalfitano A, Chamberlain JS Isolation and characterization of packaging ... lines that coexpress the adenovirus E1, DNA polymerase, and preterminal proteins: implications for gene therapy Gene Ther 1997; 4:258-63 Amalfitano A, Hauser MA, Hu H, et al Production and characterization...
Ngày tải lên: 31/10/2012, 17:08
Báo cáo y học: "Gene Therapy: The Potential Applicability of Gene Transfer Technology to the Human Germline"
... – unavailable for human germline gene therapy The lack of human ESCs leaves NT-based gene transfer as the only method that might be able to permit gene targeting in human germline gene therapy ... does appear to be somewhat better than that of pronuclear microinjection The available experimental data on standard human ICSI (i.e not involving genetic modification) indicate that: (a) the majority ... promoters and enhancers (etc) can be included in MACs Preliminary research indicates that MACs can be used, via pronuclear microinjection, to create transgenic animals in which the MACs are maintained...
Ngày tải lên: 03/11/2012, 10:01
Representations of Death A Social Psychological Perspective
... that, rather than viewing disease and death as acts of God, doctors came to see disease as a natural cause of death It therefore became acceptable for them to ‘manage’ the death bed Dying in a ... good and bad or natural and unnatural does not imply that they not have an important role to play, however Our talk about death has a very real impact on how we die, what we with our dead and ... in cases, casks, barrels, crates and hampers; salted, pickled or injected with preservative They were carried in carts and waggons, in barrows and steamboats; manhandled, damaged in transit, and...
Ngày tải lên: 07/11/2012, 14:20
computer systems- a programmer's perspective
... The American National Standards Institute (ANSI) ratified the ANSI C standard in 1989 The standard defines the C language and a set of library functions known as the C standard library Kernighan and ... between a static variable and a global variable? What happens if we define two global variables in different C files with the same name? What is the difference between a static library and a dynamic ... that of declaring a variable, except that it uses a type name rather than a variable name Thus, the declaration of byte_pointer in Figure 2.3 has the same form as would the declaration of a variable...
Ngày tải lên: 04/09/2013, 22:05
sermina lieu phap gen human gene therapy
... lợi, AAV tách ra, tạo AAV AAV có ch a phân tử AND sợi đơn có kích thước khoảng 4.5-4.7kb Hệ gen AAV có hai nhóm gen Rep Cap, có số gen khác điều khiển hoạt động AAV - Khi thiết kế vector AAV phải ... chung ch a capsid hai mươi mặt bao quanh gen dsDNA dài xấp xỉ 36kb Vỏ capsid virus ch a ba protein: hexon, fiber base penton nguyenthanhloi_2@yahoo.com 19 - Bộ gen adenovirus ch a DNA xoắn kép ... bệnh xơ gan, nghẽn mạch … nguyenthanhloi_2@yahoo.com 21 Adeno-associated Virus Cấu trúc gen kiểu hoang dại vectorAAV nguyenthanhloi_2@yahoo.com 22 4.1.4 Vector Retrovirus Retrorvirus ch a vật chất...
Ngày tải lên: 06/09/2013, 22:49
A Matter of Perspective - Point of View
... is clear, write the words used in paragraph B to replace the words in paragraph A The first replacement has been filled in to get you started PARAGRAPH A PARAGRAPH B usually always on time carefully ... convinced by paragraph B Why? Paragraph B seems more convincing because a you puts the readers into the action of the paragraph b you makes readers pay more attention c you makes readers imagine themselves ... ways to evaluate test results She has an extensive knowledge of the latest medical research, which has been invaluable What message does the writer of paragraph B convey about Nicole Bryan? a...
Ngày tải lên: 25/10/2013, 17:20
Tài liệu Cạnh tranh thông qua 3 nguyên tắc giá trị căn bản – Sự mong đợi từ phía khách hàng. HP Financial Services. Competing Through 3 Value Disciplines – A Customer’s Perspective docx
... Bank Bank Mandiri Bank Ce ntral As ia S ing apo re S to c k Exc hang e Citibank in As ia Pac ific ING in As ia Pac ific China Life – DCC SOUTH EAST ASIA HuaXia Co mme rc ial Bank China Co ns truc ... • • • • Pakistan Bangladesh Sri Lanka Cambodia Brunei Nepal Maldives Laos Singapore, 1970 APJ HQ Australia 1967 Copyright ©2003 HP corporate presentation All rights reserved New Zealand 1967 ... commercial channel partners J apan 1963 China 1985 Taiwan 1970 Southeast Asia • • • • • Philippines Thailand Vietnam Malaysia Indonesia 1995 1989 1996 1972 1996 India 1989 Hong Kong 1979 Asia emerging...
Ngày tải lên: 15/01/2014, 15:59