a developing states and the human right to health

Freedom from Want - The Human Right to Adequate Food (Advancing Human Rights series) pptx

Freedom from Want - The Human Right to Adequate Food (Advancing Human Rights series) pptx

... livestock, drinking water installations and supplies and irrigation works Although they are separate, international human rights law and international humanitarian law are strongly linked, and ... goal, as well as a moral and legal obligation It is not simply a theoretical or aspirational ideal Understanding the right to food as a human right recognizes the imperative obligation to act ... humanitarian law International humanitarian law is the branch of international law that is concerned with humanitarian action related to armed conflict situations Its origins can be traced back to a...

Ngày tải lên: 14/03/2014, 21:20

278 798 0
Tài liệu The Economic Promise of Investing in High-Quality Preschool: Using Early Education to Improve Economic Growth and the Fiscal Sustainability of States and the Nation pptx

Tài liệu The Economic Promise of Investing in High-Quality Preschool: Using Early Education to Improve Economic Growth and the Fiscal Sustainability of States and the Nation pptx

... based on a number of parental and family circumstance factors were enrolled in the Carolina Abecedarian program The infants, who were primarily African American, either received early care and ... begin school at a health, and approaches to learning.67 disadvantage because they are less likely to receive Learning is a cumulative process Many of the education at home that prepares them for ... President and Director of Research, Joseph J Minarik, for their direction and advice Thanks are also due to Rachel E Dunsmoor and Julie A Kalishman for research assistance Many thanks go to Joan Lombardi,...

Ngày tải lên: 20/02/2014, 20:20

74 608 0
The Human Race to the Future: What Could Happen - and What to Do

The Human Race to the Future: What Could Happen - and What to Do

... creative, their parents and grandparents to be more future aware, and leaders of nations around the world to take heed and act.” —Donald Maclean, MBChB, retired family physician, psychiatrist, and ... maintaining the excitement the material deserves … the book can expand your view of the possible.” —33rd Square (www.33rdsquare.com) The Human Race to the Future What Could Happen — and What to ... Acknowledgments (1 Page) About the Cover Artists and Designers (3 Pages) About the Author (1 Page) Foreword to The Human Race to the Future Comments by Gil Alterovitz and Brandon H Lee Thinking about the future...

Ngày tải lên: 11/03/2014, 18:06

1,5K 2,1K 0
MONITORING WOMEN''''S RIGHT TO HEALTH UNDER THE INTERNATIONAL COVENANT ON ECONOMIC, SOCIAL AND CULTURAL RIGHTS potx

MONITORING WOMEN''''S RIGHT TO HEALTH UNDER THE INTERNATIONAL COVENANT ON ECONOMIC, SOCIAL AND CULTURAL RIGHTS potx

... related to the right to health As important as these international human rights instruments are in establishing normative standards for human rights, the promotion and protection of the enumerated ... statistical data (although this approach may take advantage of the data when available), it is more consistent with the skills of grassroots human rights organizations A "violations approach" also ... other parts of the U.N system and the World Health Organization See Philip Alston, The Committee on Economi4 Social and CulturalRights, in THE UNITED NATIONS AND HuMAN RIGHTS: A CRTcAl APPRAISAL...

Ngày tải lên: 14/03/2014, 14:20

20 543 0
Báo cáo khoa học: A characteristic Glu17 residue of pig carnitine palmitoyltransferase 1 is responsible for the low Km for carnitine and the low sensitivity to malonyl-CoA inhibition of the enzyme docx

Báo cáo khoa học: A characteristic Glu17 residue of pig carnitine palmitoyltransferase 1 is responsible for the low Km for carnitine and the low sensitivity to malonyl-CoA inhibition of the enzyme docx

... PigE17DCPT1B and HumanD17ECPT1B, and from to 500 lm for D18PigCPT1B and D28PigCPT1B) The assay was performed at mm carnitine as standard To analyze PigE17DCPT1B and HumanD17ECPT1B mutants, the assay was ... (5¢-AGCTGAATTC ATGGCGGAAGCTCACCAG-3¢) and DH803 (5¢-TCCA CCCATGGTAGCAGAGAAGCAGCTTAAGGGTTTGG CGGA-3¢) The PCR reaction yielded a 422-bp product, in which an EcoRI site (in bold in the forward ... generated two new CPT1B mutants, pig E17D and human D17E, and analyzed the affinity for the substrate carnitine and malonyl-CoA sensitivity These mutants were active (Table 2) and expressed in P pastoris...

Ngày tải lên: 16/03/2014, 04:20

9 552 0
– ANSWERS – Set 7 (Page 13) 102. c. A leopard, cougar, and lion all belong to the cat family; doc

– ANSWERS – Set 7 (Page 13) 102. c. A leopard, cougar, and lion all belong to the cat family; doc

... more than doze, and hibernate is more than sleep The other choices are not related in the same way 246 a A banquet and a feast are both large meals; a palace and a mansion are both large places ... is to photograph as teakettle is to a cup of tea The camera is used to make the photo; the teakettle is used to make the tea 214.b Hat and mittens are to desert as snorkel and flippers are to ... Not all hurricanes cause damage (choice c) 170 c Without a signature, there is no autograph Athletes and actors (choices a and b) may sign autographs, but they are not essential An autograph can...

Ngày tải lên: 18/06/2014, 17:20

23 432 0
Báo cáo y học: " Detection of a gammaretrovirus, XMRV, in the human population: Open questions and implications for xenotransplantation" ppsx

Báo cáo y học: " Detection of a gammaretrovirus, XMRV, in the human population: Open questions and implications for xenotransplantation" ppsx

... research, areas should be identified in which this virus may cause a serious impact on human health One of these areas may be the xenotransplantation of porcine tissues and organs to humans Xenotransplantation ... PERV -A and the ecotropic PERV-C has been described in normal pigs and in melanoma-bearing animals, and recombinant PERV -A/ C was characterized by high replication titers [20-22] Whether XMRV and ... syndromes (AIDS), and the human T-lymphotropic viruses, HTLV-1 and HTLV-2, which induce adult T-cell leukaemia and HTLV-associated myelopathy/tropical spastic paraperesis, have been proven to be linked...

Ngày tải lên: 12/08/2014, 23:23

3 291 0
Prospects for the united states and the world a crisis that conventional remedies cannot resolve

Prospects for the united states and the world a crisis that conventional remedies cannot resolve

... FA is the real stock of assets of the private sector, and Z represents additional vari- ables that affect the propensity to spend out of income and wealth for households and business taken together ... in Figures and alternative projections for the main financial balances, output, and unemployment, based on the assumption that fiscal stimuli are immediately applied equal to an increase in government ... is assumed to adjust toward a stable stock-flow norm, with additional impacts arising from borrowing and capital gains That is to say, PXt = c0 + c1YDt + c2FAt-1 + Zt where YD is real disposable...

Ngày tải lên: 23/09/2015, 08:52

8 259 0
FOCUS ON - phrasal ver bs with the particle off and the adverb right

FOCUS ON - phrasal ver bs with the particle off and the adverb right

... called you earlier Janice left a message asking me to call her back Bob was called back by the salesman call back p.v When you leave a place or walk away from a person and are then asked to return, ... p.v When a gathering of people separates, it breaks up When the police tell people who are gathered together in a crowd to separate and leave the area, the police break the gathering up The meeting ... promised to come to his house, but he didn't What happened to Mike? Karen called Sarah, but Sarah was at school Sarah didn't call Karen later What didn't happen to Karen? A supermarket chain gave the...

Ngày tải lên: 01/11/2013, 12:20

21 537 0
Tài liệu NEW EUMEMBER STATES AND THE DEPENDENT ELDERLY doc

Tài liệu NEW EUMEMBER STATES AND THE DEPENDENT ELDERLY doc

... 10,000 inhabitants has increased in recent years In Cyprus, Slovenia and Estonia it has remained stable, whereas it has fallen in Latvia, Lithuania and Poland For the most part, the poor wages on ... view of the decreasing availability of family care, the dependent elderly have to turn to the two other players: the public and private sectors Notwithstanding aspirations towards a certain degree ... Germany Finland Denmark Austria Spain Belgium Slovenia Czech Republic France Latvia Estonia Malta Portugal United-Kingdom Hungary Lithuania Cyprus Luxemburg Poland Ireland Netherlands -5 Slovak...

Ngày tải lên: 14/02/2014, 06:20

28 544 0
Tài liệu Carrots, Sticks, and Promises: A Conceptual Framework for the Management of Public Health and Social Issue Behaviors docx

Tài liệu Carrots, Sticks, and Promises: A Conceptual Framework for the Management of Public Health and Social Issue Behaviors docx

... severe laws and advocate education to inform and persuade relevant populations as to appropriate behavior The predicted and tolerable level of externalities for tobacco use have changed dramatically ... the target a brand of soap and a rationale as to why the soap's benefits and rewards are superior to remaining dirty To sell brotherhood like soap, there must be soap; however, in too many cases ... philosophic base Many policymakers and social marketing managers now seem to regard social marketing as consisting of educational (informative and/ or persuasive) messages and seem to be unaware that the...

Ngày tải lên: 18/02/2014, 02:20

14 789 0
The Right to Health pdf

The Right to Health pdf

... WHAT IS THE RIGHT TO HEALTH? A.   Key aspects of the right to health • The right to health is an inclusive right.  We frequently associate the right to health with access to health care and the ... capacity of WHO and its member States to integrate a human rights-based approach to health; advance the right to health in international law and international development processes; and advocate ... the right to life, the prohibition on torture and other cruel, inhuman and degrading treatment, and the right to family and private life Finally, the right to health or the right to health care...

Ngày tải lên: 05/03/2014, 10:20

52 369 0
Straddling Economics and Politics - Cross-Cutting Issues in Asia, the United States, and the Global Economy.pdf pot

Straddling Economics and Politics - Cross-Cutting Issues in Asia, the United States, and the Global Economy.pdf pot

... size and growth, on the one hand, and their military capabilities, on the other While these are certainly not the only ingredients of national power, they are among the most salient as well as the ... reality Chapter FINANCIAL CRISES AND THE CHALLENGE OF “MORAL HAZARD” In the innumerable discussions and debates about Asia’s financial turmoil, typically dated from the collapse of the Thai baht on ... both academic and policy circles James Barth, Dan Bumbaugh, Lalita Ramesh, and Glenn Yago The East Asian Bank- ing Crisis.” Jobs and Capital, Summer/Fall 1998, p 35 David Hale The IMF,...

Ngày tải lên: 06/03/2014, 17:20

228 601 1
Báo cáo khoa học: Identification of NF1 as a silencer protein of the human adenine nucleotide translocase-2 gene pptx

Báo cáo khoa học: Identification of NF1 as a silencer protein of the human adenine nucleotide translocase-2 gene pptx

... were dried and autoradiographed Competitor DNAs used in EMSA analysis were: NF1 wt, 5¢-TTTTG GATTGAAGCCAATATGATA-3¢; NF1 mut, 5¢-TTTT GGATTGAATAAAATATGATA-3¢; Site-2 wt, 5¢-GCGT CTCACCCTAGTCCTGGTCCTGCTCCAAGGGTTTT ... (5¢-TGACCTTGTCTCGTTGCCTCACCC-3¢) and )378 (5¢-GCTACAGGGATGCCAAAAGAACCC-3¢) for the Site-3, and primer set )346 (5¢-GCGTCTCACCCTAGT CCTGGTCCTGC-3¢) and )214 (5¢-GGAAGGGGCGGG TCCAGAGAACA-3¢) for the Site-2 element PCR was performed ... N.), the Slovak Science and Technology Assistance Agency (APVT) Grant 26-002102 and the Slovak Grant Agency (VEGA) 2/3087/23 (to ¨ K L.) The authors thank O Wrange for recombinant human NF1 and...

Ngày tải lên: 07/03/2014, 15:20

8 427 0
Báo cáo khoa học: Recent insights into cerebral cavernous malformations: animal models of CCM and the human phenotype pptx

Báo cáo khoa học: Recent insights into cerebral cavernous malformations: animal models of CCM and the human phenotype pptx

... rescue the B Fig Narrowed arteries associated with circulation failure in mice lacking Ccm2 The connections of the heart to the aorta, and the associated cranial portions of the dorsal aorta are narrowed ... connect the developing heart to the developing aorta with a functioning, patent first branchial arch artery The associated rostral portions of the aorta are similarly narrowed (Fig 3) As a result, ... Yamazaki K, Gohda J, Akiyama T, Semba K, Goto H, Kato A, Yujiri T, Imai T et al (2009) TRAF6 establishes innate immune responses by activating NF-kappaB and IRF7 upon sensing cytosolic viral RNA and...

Ngày tải lên: 15/03/2014, 10:20

8 420 0
Báo cáo khoa học: ERS1 encodes a functional homologue of the human lysosomal cystine transporter pptx

Báo cáo khoa học: ERS1 encodes a functional homologue of the human lysosomal cystine transporter pptx

... migrated as a sharp band Taken together, these data demonstrate that the B Fig The N-terminal myristoylation consensus sequence is required for Meh1 function and vacuolar membrane association (A) ... USA 92, 1287– 1291 Gaxiola RA, Rao R, Sherman A, Grisafi P, Alper SL & Fink GR (1999) The Arabidopsis thaliana proton transporters, AtNhx1 and Avp1, can function in cation detoxification in yeast ... endosomes as well as the vacuole, Meh1 appears to be largely confined to the vacuolar membrane Nonetheless, taking together both the genetic and subcellular localization data, these results provide...

Ngày tải lên: 16/03/2014, 18:20

15 379 0
w