... increasingly aware of the environmental impact of their clothing purchases and are seeking brands that use sustainable materials and ethical labor practices The demand for diversity and inclusivity in fashion ... Based on the revenue figures from the company's financial year 2018, Spain-based retailer Zara (Inditex) ranked as the leading fast-fashion company in Europe In that year, Zara generated around ... to racial discrimination quite a few times in the past as well such as when a manager and a few employees were fired because they changed the name of a product in the store to include a racial
Ngày tải lên: 04/07/2025, 09:04
... However, there is a constellation oftypes of affective episodes that are not part of the officialclassification and they are so prevalent in real life clinicalpractice that many authors consider them ... 'crimes of passion' being the most tragic result The drug abuse pattern of BD patients tends toward the abuse of stimu-lant drugs Familial diathesis for mania is significantly associated with the abuse ... especially the ventro-medial areas as well as the amygdala and the hippocampus Mood disorders are characterised by a constellation of symptoms and signs The terms 'depressed mood', 'anhe-donia' and
Ngày tải lên: 08/08/2014, 23:21
Project a “better version” of the cups coffee subject service operation management
... staff cleans the table after guests leave (standing area: the entrance) Table 3.1 Job description of The Cups Coffee’s staff in a shift As a result of the previous, we have a process flow diagram ... Relatively hard to change Relativel y hard to change (quantity and type of tables) Easy to change layout, decoration concept Hard to change the location but we can change the arrangement of ... Picture 4.3 Facilities of The Cups Coffee Cups Coffee functions as both a glass cabinet and a factory, serving as a dual-purpose space that showcases both tangible materials and intangible experiences
Ngày tải lên: 02/03/2023, 19:11
An analysis of nouns formed by suffixes in english a case study of the textbook solutions pre intermedite
... the suffixes in English 3.8 “Wave power” (Tim Fall and Paul A Davies, 2007: 78) 40 Active volcano on La Palma in the Canary Island would cause a tsunami – an enormous wave The volcano is by the ... like other languages, makes great contribution to the variety and diversity of the cultural exchange and to the social development and advancement English vocabulary contains a lot of complicated ... the sea If the volcano collapsed, 500 billion tones of rock would fall into the sea The wave would travel away from the Canary Island in all directions at about 800km/h The wave would have enough
Ngày tải lên: 14/12/2013, 16:45
Tài liệu A Brief History Of The English Language Eckersley 1960 ppt
... Danish King, Canute, became King of all England as well as of Denmark and Norway The language spoken by the Danes was not unlike the Janguage of England—words like mother and father, man and ... Greek, Latin; and there is the Eastern group containing Balto-Slavonic, Indo-Iranian, Albanian and Armenian The chart on page 421 will show the modern descendants of Indo-European and their relationship ... Hampshire and the Isle of Wight; the Saxons in the rest of Southern England south of the Thames; the Angles in the land north of the Thames Each of the three tribes spoke a different form of their
Ngày tải lên: 25/12/2013, 13:15
Tài liệu A PRELIMINARY ANALYSIS OF THE EFFECTS OF HR 2454 ON U.S. AGRICULTURE doc
... hence, putting them at significant market disadvantage The bill sets a maximum amount of allowances that can be rebated to EITE industries at, 2% for 2012 and 2013, 15% in 2014, and then declining ... long-term analysis we assume the structure of the agricultural economy in the United States remains stable That is, the role of energy in agriculture remains the same over time The relation between ... energy-related expenses, other farm expenses, and the value of agricultural production stays the same.10 To assess the impacts of HR 2454 beyond 2018, we assume the underlying structure of the agricultural
Ngày tải lên: 21/02/2014, 01:20
Tài liệu Does Foreign Direct Investment Work For Sustainable Development? A case study of the Brazilian pulp and paper industry potx
... social and environmental - to compare their performance The main findings are: concerning economic performance, national and transnational companies are similar; national companies are ahead on the ... human capital formation required in the sector A preliminary analysis of the TNCs role in the Brazilian pulp and paper sector based on the available studies and data points to their potential ... picture of the participation of TNCs in the Brazilian pulp and paper sector is presented The empirical research and findings are detailed in the third section 1 Transnational Companies and Sustainable
Ngày tải lên: 22/02/2014, 09:20
A Text-Book of the History of Architecture Seventh Edition, revised pdf
... of the points of support, and hence the nature of the structural design. A comparison, for example, of the plans of the Hypostyle Hall at Karnak (Fig. 11, h) and of the Basilica of Constantine ... and accurate the author’s name is a sufficient guarantee. Essential historical and biographical facts, together with brief critical estimates and characterizations of leading schools and painters, ... architecture. In the North and West, meanwhile, under the growing institutions of the papacy and of the monastic orders and the emergence of a feudal civilization out of the chaos of the Dark
Ngày tải lên: 05/03/2014, 14:20
An Outline of the Development OF THE Internal Commerce of the United States 1789-1900 pot
... features of the internal commerce following 1830 was the rise of the trade on the Great Lakes After the opening of the Erie Canal there was a large migration to the lands around the lakes; in a ... Erie Canal and the lakes, and by 1854 the amount reached $94,000,000 After the latter year there was a rapid decline in the merchandise traffic over the canal and lake route because of railway competition ... slaves, was almost negligible In 1849 when the Western Atlantic Railroad began to run trains from Chattanooga to the Atlantic coast, the planters of Northern Alabama and Tennessee, who had always
Ngày tải lên: 05/03/2014, 16:20
Báo cáo khoa học: Nup358, a nucleoporin, functions as a key determinant of the nuclear pore complex structure remodeling during skeletal myogenesis docx
... 5¢-GCAGCAUCUUUAAU-GAAUAdTdT-3¢ and 5¢-AUAAGUAAUUUCUACGACG dTdT-3¢; Nup358, 5¢-CCAGUCACUUACAAUUAAAd TdT-3¢ and 5¢-UUUAAUUGUAAGUGACUGGdTdT-3¢ (siNup358-1), 5¢-UGAAGCACAUGCUAUAAAAdTdT-3¢ and 5¢-UUUUAUAGCAUGUGCUUCAdTdT-3¢ ... RevNES (5¢-GATCTCCTCTTCAGCTA CCACCGCTTGAGAGACTTACTCTTGATTGTAACGA GGATA-3¢ and 5¢-AGCTTATCCTCGTTACAATCAA GAGTAAGTCTCTCAAGCGGTGGTAGCTGAAGAGG A-3¢) were annealed and inserted into the BglII and HindIII ... is abun-dant in the nucleus as a result of the activity of RCC1, a guanine nucleotide exchange factor for Ran Con-versely, the concentration of RanGDP is high in the cytoplasm as a result of the
Ngày tải lên: 06/03/2014, 01:20
CORREGGIO A COLLECTION OF FIFTEEN PICTURES AND A SUPPOSED PORTRAIT OF THE PAINTER, WITH INTRODUCTION AND INTERPRETATION pot
... TRELLIS) (S Paolo, Parma) In the time of Correggio the convent of S Paolo (St Paul) in Parma was in charge of the abbess Giovanna da Piacenza, who had succeeded an aunt in this office ... Portrait frontispiece. From a photograph of an alleged portrait of Correggio in the Parma Gallery. 1. The Holy Night.(La Notte.) (Detail.) Painted at the order of Alberto Pratoneri for the altar ... sister of the sun-god Apollo As the rays of moonlight seem to pierce the air like arrows, Diana, like Apollo, was said to carry a quiver of darts; the slender arc of the crescent
Ngày tải lên: 06/03/2014, 13:20
Chart of Accounts: A Critical Element of the Public Financial Management Framework potx
... Note: Sailendra Pattanayak is a Senior Economist in the Fiscal Affairs Department of the International Monetary Fund; Julie Cooper was a Technical Assistance Advisor in the Fiscal Affairs Department. ... 2INTerNATIoNAl MoNeTAry FUNDFiscal Affairs DepartmentChart of Accounts: A Critical Element of the Public Financial Management Framework Prepared by Julie Cooper and Sailendra PattanayakAuthorized for ... Trang 1International Monetary Fund Fiscal Affairs Department Julie Cooper and Sailendra Pattanayak Fiscal Affairs Department T e c h n i c a l n o T e s a n d M a n u a l s Trang 2INTerNATIoNAl
Ngày tải lên: 06/03/2014, 15:21
A Joint Publication of the Office of the Attorney General and the Department of Business and Economic Development docx
... require the personal guarantees of corporate shareholders as a condition of making a loan to the corporation Articles of Incorporation SDAT provides standardized fill-in-the-blank examples for ... Maryland name and address of corporation’s resident agent authorized number, class, and par value, if any, of shares a description of each class of stock, if applicable number and names of corporation’s ... restore, and enhance nontidal wetlands and streams; provide training and technical assistance and assist in the development of watershed management plans 68 water and sewerage Inspect industrial and
Ngày tải lên: 06/03/2014, 21:20
A JOINT PROJECT OF THE AMERICAN ACCOUNTING ASSOCIATION AND THE ACCOUNTING PROGRAMS LEADERSHIP GROUP pdf
... REPORT OF THE AAA/AAPLG AD HOC COMMITTEE TO ASSESS THE SUPPLY AND DEMAND FOR ACCOUNTING PH.D.s A JOINT PROJECT OF THE AMERICAN ACCOUNTING ASSOCIATION AND THE ACCOUNTING PROGRAMS LEADERSHIP ... Israel and the Middle Easta Europe Latin and South America Africa Australia and Oceania Total Non-North American Total respondents a Number... 12-month amounts typically said no additional ... of the AAA/AAPLG Ad Hoc Committee to Assess the Supply and Demand for Accounting Ph.D.s 1 REPORT OF THE AAA/AAPLG AD HOC COMMITTEE TO ASSESS THE SUPPLY AND DEMAND FOR ACCOUNTING PH.D.s A JOINT
Ngày tải lên: 06/03/2014, 21:20
DEVELOPING A COMPETITIVE STRATEGY: A CASE STUDY OF THE THANGLONG GARMENT COMPANY IN HANOI, VIETNAM
... Thaloga focuses on mass market as their target market. Customers in this market are featured with average income and average living standard. Geographically, the market of the company is in Hanoi ... sustain this advantage to maintain high profit rate over a number of years. This definition uses profit rate as a measurement to rate the competitive advantage. In other view, we can say that a ... The information in Table 19 does not indicate market share of each company in the table, but we can understand that Thaloga might have a large market share of jacket in domestic market, company...
Ngày tải lên: 23/04/2013, 10:29
A Quick Tour of the C++CLI Language Features
... in the declaration. The managed array is a reference type, so the array and its values are allocated on the managed heap. So what exactly can you embed as fields in a managed type? You can embed ... such a class is not quite the same as an interface. An interface class has no fields and no method implemen- tations; an abstract base class may have these. Also, multiple interface classes may ... example. The previous sections demonstrated the declaration and use of managed aggregate types, including ref classes, value classes, managed arrays, enum classes, and interface classes. In the...
Ngày tải lên: 05/10/2013, 08:20
A Brief Tour of the X Display Environment
... on a totally separate system. The variants of the Microsoft Windows operating system cannot export the display of an individual application to be viewed on a separate machine. If an application ... is because you are attaching to one end of the ssh tunnel. The other end of the tunnel is on Machine A, which is where the appli- cation is actually displayed. The authority and display are now ... Window Sometimes application owners may need root access on a system, such as when applica- tions that are owned and managed by someone other than the administrator need to run as root because of their...
Ngày tải lên: 05/10/2013, 08:51
The pursuit of the subject - literature as critic and perfecter of philosophy 1790-1830
... twofold analysis of text and context. Grammatical analy- sis covers the externality of the language used. From this standpoint the author is merely the site of a particular utterance, the meaning ... fact the power of musical harmony guarantees that new order and form ensue. The poem is thus revealed as an allegory of the relevance of aesthetic grace to the social problem. Even the natural ... had tentatively offered aestheticisation as a means of popularising specialist professional science, and Jean Paul had argued in Das Kampaner Thal for the poet’s ability to intuit natural truths...
Ngày tải lên: 01/11/2013, 09:20
A contrastive analysis of the meanings expressed via the modal verbs can, may, must in english and the equivalent expressions in vietnamese
... Summary Chapter 2 has presented the conventional meanings of the modals can, may, must and has dealt with the contrastive analysis of the meanings expressed by these modal verbs and the equivalent ... effort has also been made to have a contrastive analysis of the meanings expressed via the modal verbs can, may, must and the equivalent expressions in Vietnamese. The analysis has shown that there ... via Vietnamese modal verbs. The examples analyzed have partly revealed the ambiguity in meaning of Vietnamese modal verbs. This is the reason that causes the learners’ confusion. Vietnamese language has more...
Ngày tải lên: 29/01/2014, 00:23
Tài liệu Báo cáo khoa học: The Arabidopsis protein kinase Pto-interacting 1-4 is a common target of the oxidative signal-inducible 1 and mitogen-activated protein kinases docx
... 5-GACGAGATTATC AGATTTTACGC-3 and 5-AACTGGTGAAGCGGAAG AGAC-3, PTI1-4 (At2g47060): 5-CCCCAAAGAAAATG AGTTGCT-3 and 5-GCATCATTTCCTGGAGGAAAG-3. Acknowledgement This project was supported by grants from the Aus- trian Science ... ACTIN2 gene as an internal standard. PCRs were performed using the following primers: ACT2 (At3g18780): 5-ACATTGT GCTCAGTGGTGGA-3 and 5-CTGAGGGAAGCAAG AATGGA-3, OXI1 (At3g25250): 5-GACGAGATTATC AGATTTTACGC-3 ... 1425. 39 Matsuoka D, Nanmori T, Sato K, Fukami Y, Kikkawa U & Yasuda T (2002) Activation of AtMEK1, an Ara- bidopsis mitogen-activated protein kinase kinase, in vitro and in vivo: analysis of active...
Ngày tải lên: 14/02/2014, 19:20
Bạn có muốn tìm thêm với từ khóa: