a decision support model for gediz basin turkey

... industries are South Korea and Taiwan [43] In January 2011, China has started a recycling policy based on EPR Other developing countries in Asia such as Thailand, Malaysia, Vietnam and Indonesia are also ... enormous amount of data related to complex and dynamic environments into manageable and meaningful information [56] For sustainable production, indicators can assist in the decision- making for and management ... Planning  Based on available and accurate data  Verifiable  Based on a set of indicators rather than a single indicator  Comprised of core and supplemental indicators  Addressing all six aspects...

Ngày tải lên: 09/09/2015, 11:16

... group for both the signal representation approach and the signal modelling approach in the univariate and bivariate cases Once the features were available, classification was performed using a simple ... frontal left lobes of Alpha and Gamma2 band and central lobes of the Alpha band Alterations in the Alpha band are also expected since they are generally associated with problems in attention and ... years analyzed in [32] have also shown an increase in theta and alpha power When considering the mathematical subtraction Task the most significant bands (Table 2) are Theta, Beta and Gamma2...

Ngày tải lên: 19/06/2014, 08:20

... medical domain FEATURES EXTRACTION AND CASE FORMULATION Extracting appropriate features is of great importance in performing accurate classification in a computer-aided system whereas in manual ... diagnosis/classification tasks in the medical domain Montani et al (2001) has combined case-based reasoning, rule-based reasoning (RBR), and model- based reasoning to support therapy for diabetic patients Auguste ... the maximum feature value for a feature f between the whole case base and a query case C and Min retrieves the minimum feature value for a feature f between the whole case base and a query case...

Ngày tải lên: 07/12/2013, 11:41

... translated in a full knowledge of the building graph and a calculation of the shortest paths by using Dijkstra’s algorithm An evacuee becomes aware of a hazardous area when it reaches a location ... structure before the hazard starts spreading We consider that the evacuees are familiar with all the available exits and are able to follow the shortest paths that lead to them In terms of modelling, ... interaction between an evacuee and a Decision Node can be accomplished by either a visual indicator (such as a smart panel) or a wireless communication device (such as a PDA) which is carried...

Ngày tải lên: 07/12/2013, 11:41

... multicriteria value analysis and decision conferencing: A case study International Transactions in Operational Research, 13(4), 279-297 Bana e Costa, C .A. , Lourenço, J.C., Soares, J.O., 2007 An interval ... References Bana e Costa, C .A. , 1990 An additive value function technique with a fuzzy outranking relation for dealing with poor intercriteria preference information In C .A Bana e Costa, ed Readings ... support system for portfolio robustness evaluation that integrates two main architectural components: a multicriteria decision analysis (MCDA) component and a portfolio decision analysis (PDA) component...

Ngày tải lên: 07/12/2013, 11:41

... and plan for a strategy in educational management of organizations in Vietnam and Asia [3] However, there are no DSS applications to apply a real case in the domain of an evaluation and a strategic ... standards have been adopted by more than 74 countries as national standards for quality assurance The representative of ISO for the USA is the American National Standards Institute (ANSI) and ... hierarchy Level – Alternatives: Choosing the best choice decision among alternatives for an evaluation model / a strategic university planning DSS model application for an evaluation and a strategy...

Ngày tải lên: 05/03/2014, 14:20

... rotation (45 years) and thinnings that are designed so as to maintain a constant and relatively low basal area after each cycle (15 m3 ha−1 ) The rotation of scenario is fixed to 60 years As for ... plain or transformed) to expand the information on explanatory variables A selection based on different aspects was considered: available variables, desirable variables with a high biological expression, ... Silvicultural decision support system for larch Table I Parameters of the Duplat and Tran-Ha model IV used to describe the dominant height of larch Japanese larch European larch Hybrid larch a = 7.500786...

Ngày tải lên: 07/08/2014, 16:21

... T., Pascual L., Trasobares A. , Examining alternative landscape metrics in ecological forest landscape planning: a case for capercaillie in Catalonia, Investigaciones Agrarias, Sist Recur For 13 ... specification of simulation parameters and silvicultural practices (Fig 1) For example, the user interface encompasses a set of forms with ranges of feasible values for parameters such as rotation age ... tree information and specific ecological data Third, an additional capability for linking financial and economic data, i.e unit costs and prices, to cultural treatments is key for estimating revenue...

Ngày tải lên: 08/08/2014, 00:22

... generate standard curves For each biological sample and each extension primer (1F, cagtccagtgagacacatggttg; FA1, gttaaacccacagggcaagagc), six reactions were performed, pooled, purified with a QiaQuick ... mathematical models, performed Acknowledgements We thank Annie Varrault, Luisa Dandolo, Laurent Journot, Georges Lutfalla, Jean-Marc Victor, Jacques Piette and Jean-Marie Blanchard for stimulating ... domains are fully compatible with a statistical helix organization Compared to mammals, chromatin dynamics in yeast can be described as a statistical helix that would have a slightly smaller diameter...

Ngày tải lên: 09/08/2014, 22:24

... to rate the readability, understandability, and format of the COPE sheet using a verbal five-point Likert scale Data collection and analysis All usability sessions were audiotaped and transcribed ... from direct observation of participants Quantitative data Quantitative data were analysed using frequency analysis of demographic questions, task accuracy, and frequency and classes of problems ... verbatim Usability study was also videotaped to observe users’ physical behaviour as they interacted with the RAQ Data collection and analysis consisted of a combination of qualitative analysis...

Ngày tải lên: 10/08/2014, 10:23

... osteoporosis risk management strategies Trials 2008, 9(1):62 39 Public Health Agency of Canada Canada’s Aging Population: Who are Canada’s Seniors? Division of Aging and Seniors, Health Canada 2002; [http://www.phac-aspc.gc.ca/seniors-aines/publications/public/various-varies/ ... physicians and patients This benefit may include an increased awareness for patients about osteoporosis and its associated risks, the availability of relevant information about what they can about ... unpredictable elements can be controlled statistically We will use the ARIMA approach to analyze our data to control for the effects of variability Additionally, we will also ensure that any variability...

Ngày tải lên: 10/08/2014, 11:20

... Filippi A, Sabatini A, Badioli L, Samani F, Mazzaglia G, Catapano A, Cricelli C: Effects of an automated electronic reminder in changing the antiplatelet drug-prescribing behavior among Italian general ... provided administrative, technical, or material support LWK and TN acquired data and drafted the manuscript NLW acquired, analysed, and interpreted data; drafted the manuscript; provided administrative, ... influenza vaccination for children and adolescents with asthma in primary care Online reminders for tetanus, hepatitis, pneumococcal, measles, and influenza vaccinations for adults in primary care...

Ngày tải lên: 10/08/2014, 11:20

... manuscript; and provided statistical analysis LWK and TN acquired data and drafted the manuscript NLW acquired, analyzed, and interpreted data; provided administrative, technical, or material support; and ... statistical analysis AH analyzed and interpreted data as well as critically revised the manuscript MT critically revised the manuscript JAM acquired, analyzed, and interpreted data; drafted the manuscript; ... to increase beta-blocker use in heart failure Circulation 2003, 107(22):2799-2804 Filippi A, Sabatini A, Badioli L, Samani F, Mazzaglia G, Catapano A, Cricelli C: Effects of an automated electronic...

Ngày tải lên: 10/08/2014, 11:20

... manuscript; and provided statistical analysis as well as administrative, technical, or material support LWK and TN acquired data and drafted the manuscript NLW acquired, analyzed, and interpreted data; ... statistical analysis SJC analyzed and interpreted the data; and critically revised the manuscript JAM acquired, analyzed, and interpreted data; drafted the manuscript; critically revised the manuscript; ... meta-analysis to assess the average effect size Where studies did not report data in a suitable form for pooling, authors were contacted for additional information, and appropriate data were estimated [40]...

Ngày tải lên: 10/08/2014, 11:20

... shared decision- making ▪ Making DST available ▪ Integrating DST in the consultation ▪ Managing time to process patients ▪ Managing patients who not enter into shared ... physical media ▪ Allocating time ▪ Appraising value ▪ Negotiating with managers ▪ Managing medico-legal concerns promote informed choice, involvement in decision- making ... shared decision- making ▪ Concept of shared decision- making ▪ New role as participant ▪ Cognitive engagement with DST ▪ Understanding and assessing outcomes ▪ Decisional...

Ngày tải lên: 11/08/2014, 16:21

... 96(19):1420-5 Australian Institute of Health and Welfare (AIHW), Australasian Association of Cancer Registries (AACR) Cancer in Australia In: Cancer in Australia 2001; Cancer series number 28 Canberra: Australian ... Karakosta A, Golias Ch, Charalabopoulos A, et al Genetic models of human cancer as a multistep process Paradigm models of colorectal cancer, breast cancer, and chronic myelogenous and acute lymphoblastic ... colorectal cancer detection A total of 264 serum samples from colorectal cancer patients and healthy volunteers was collected and analyzed A panel of differentially expressed proteins was advocated for...

Ngày tải lên: 25/10/2012, 11:18

... concept as a strategic performance management system Kaplan and Norton (1996) define balanced scorecard concept as follows: ‘‘The balanced scorecard retains traditional financial measures But financial ... and innovation.” A strategic planning study such as balanced scorecard is very useful from vision to action Kaplan and Norton (1996) state that ‘‘the balanced scorecard translates an organization’s ... vision was determined by using a balanced scorecard project A management consultant managed the balanced scorecard project and the top management supported this strategic management application...

Ngày tải lên: 07/12/2013, 11:41

... boundary and the boundary variables are treated as P0 / -S primal events The unit models describe both normal and failed behavior and depend on a wide variety of operating parameters and failure ... the causal relationships between variables including normal and failed states The basic elements of a digraph are shown in figure for conduction in a wire Node labels represent deviation variables, ... are a member of the Reliability Proceedings Annual Reliability and Maintainability Society Symposium for 1982 & 1983 Proceedings Annual Reliability and Maintainability Proceedings International...

Ngày tải lên: 03/01/2014, 19:37

... context and make decisions based on that model With reasonable support and information, decision makers arc likely to develop a prudent model, Without reasonable support and information, decision makers ... 274 CONTENTS X Part I I I ISSUES OF DESIGN 277 INTERNATIONAL DECISION SUPPORT SYSTEMS Information Availability Standards Data Privacy Data Availability Data Flow Cross-Cultural Modeling Effects ... improve asset acquisition and management, talent management and operational performance Billy Beane showed the world that his ideas about using analytics could produce a low-co st baseball team that...

Ngày tải lên: 14/02/2014, 12:20

... refund a bond issue would have to be evaluated on a case by case basis to calculate the exact costs or savings produced by the various interacting variables Consequently, there is a need for an interactive ... interest rate (for floating-rate bonds only) For the purposes of the model, some assumptions or forecasts have to be made about the future behavior of the market interest rate Examples are (a) a worst ... (c) randomly generated market rates Other, customized, market interest rate assumptions can readily be made as appropriate Information about the old bond and the new bond Specifically, for both...

Ngày tải lên: 15/02/2014, 13:20