a cuantitative study with generalized additive models

... for retrieval fusion Generalized Additive Models Generalized Additive Models (GAMs) are a generalization of Generalized Linear Models (GLMs), 463 Here, Xi is the ith row of the model matrix X (one ... international conference on Information and knowledge management, pages 538–548, New York, NY, USA ACM Pavel Pecina, Petra Hoffmannova, Gareth J.F Jones, Jianqiang Wang, and Douglas W Oard 2007 ... channel was down-sampled to 8kHz and segmented using an available broadcast news segmenter Because we did not have a pronunciation dictionary which covered the transcribed audio, we automatically...

Ngày tải lên: 08/03/2014, 01:20

... (mean 71.4 years) at p = 0.015 Instruments Socio-demographic and clinical data Information on socio-demographic data such as age, educational level, cohabitation and marital status was obtained by ... multidimensional QOL of a reasonably sized sample of female MI survivors and that of the general female population of the same age range, as well as a thorough evaluation of the clinical importance of ... statistical software R (The R Foundation for Statistical computing, Vienna, Austria) was used for bootstrap analyses (R package boot) and permutation tests All other analyses were performed with...

Ngày tải lên: 20/06/2014, 16:20

... CCCUGCCGUACCCGGGUCGAAUUCG ACCCCUUGUCUGG A GCGGAUGUAUU UUGGGAGGGUAGCUGGCGGAGG CCUCGGCCCAGGAAGCUAUGCAUGC CCCUGCCGUACCCGGGUCGAAUUCG ACCCCUUGUCUGGGGCGGAUGUAUU U A GGGAGGGUAGCUGGCGGAGG CCUCGGCCCAGGAAGCUAUGCAUGC ... CCCUGCCGUACCCGGGUCGAAUUCG ACCCCUUGUCUGGGGCGGAUGUAUU UUGGGAGGGUAGCUGGCGGAGG CCUCGGCCCAGGAAGCUAUGCAUGC CCCUGCCGUACCCGGGUCGAAUUCG ACCCCUUGUC C GGGGCGGAUGUAUU UUGGGAGGGUAGCUGGCGGAGG CCUCGGCCCAGGAAGCUAUGCAUGC CCCUGCCGUACCCGGGUCGAAUUCG ... CCUCGGCCCAGGAAGCUAUGCAUGC CCCUGCCGUACCCGGGUCGAAUUCG ACCCCUUGUCUGGGGCGGAUGUAUU UUGGGAGGG A AGCUGGCGGAGG CCUCGGCCCAGGAAGCUAUGCAUGC CCCUGCCGUACCCGGGUCGAAUUCG ACCCCUUGUCUGGGGCGGAUGUAUU UUGGGAGGGU G GCUGGCGGAGG CCUCGGCCCAGGAAGCUAUGCAUGC...

Ngày tải lên: 22/06/2014, 23:20

... lung sealant an intraoperative air leak test during lung inflation was carried out to evaluate the location and grade of air leaks as described above In the event of a grade air leak additional suture ... to access by standard suturing or fleece-bond sealants, PleuraSeal™ as a liquid sealant is ideal to seal air leaks in this interlobar space with its many anatomical variations As part of this Protocol ... parenchyma with warm saline and retested under pressure to confirm that all alveolar air leaks had been successfully halted with the study sealant, and in only one patient was an additional application...

Ngày tải lên: 10/08/2014, 09:22

... Kenya Association of Professional Counsellors (KAPC) conference for sub-Saharan Africa SAHARA J 2004, 1(3):175-181 Mahendradhata Y, Andono Ahmad R, Lefèvre P, Boelart M, Van der Stuyft P: Barriers ... 2004 Daftary A, Padayatchi N, Padilla M: HIV testing and disclosure: a qualitative analysis of TB patients in South Africa Aids Care 2007, 19(4):572-577 Yawn BP: The impact of childhood asthma on ... facilities, staff, and availability of treatment and support The provision of health education to patients was most often mentioned as a facilitating factor The second most cited factor was the availability...

Ngày tải lên: 10/08/2014, 10:23

... (carbamylcholine) and ligand-free conformations, have recently shown that local rearrangements associated with agonist binding propagate through beta strands to the pore domain [35-37] By analogy with the AChBP ... subunits alpha2, delta and gamma, and the Floop in alpha2; but they are restricted in the C-loop of α1, F-loop in gamma, Cys loop and loop A in alpha2, and Cys and F-loop in delta (Fig 4A) It seems ... receptor, at the interfaces formed between two subunits: alpha1 with gamma, and alpha2 with delta (not shown here) The toxin lies almost equatorially to the extracellular domain of the nAChR, as previously...

Ngày tải lên: 13/08/2014, 16:21

... replicates of the MOET scheme, au= additive genetic variance) Table I Average treatment treatment as a ) h (a 2.3 Statistical models and computations Three linear statistical models were compared, ... Production, Armidale, Australia, 1998, vol 25, pp 605-612 [27] Uimari P., Mantysaari E .A. , Repeatability and bias of estimated breeding values for dairy bulls and bull dams calculated from animal model ... treatment was prevalent (1/10) and the herd-year variance was large, the e = posterior distribution was sharp, with a modal value of v at all levels of uncertainty This points away from a Gaussian...

Ngày tải lên: 09/08/2014, 18:21

... University of Salamanca, 37007 Salamanca, Spain 3Primary Care Research Department, 6th Health Area, Servicio Madrileño de Salud, 28020 Madrid, Spain 4Psychiatry Department, Hospital Puerta de Hierro, ... medications were made by means of a chi-square test for qualitative variables and by analysis of variance (ANOVA) for quantitative variables The associations between the presence of PPS and functioning ... difficulties Patients also experience a range of somatic symptoms such as cold clammy hands, dry mouth, sweating, nausea, and diarrhea [13] Additionally, patients with GAD often complain about muscle pain...

Ngày tải lên: 11/08/2014, 15:22

... Generalized linear models with random effects; a Gibbs sampling approach J Am Stat Assoc 86, 79-86 Zeger SL, Liang KY, Albert PS (1988) Models for longitudinal data: a generalized estimating equation ... situations arising in animal breeding such as, eg, sire, sire and maternal grand sire, and animal models on one hand, and direct and maternal effects on the other hand A simple example of that ... Rae A (1985) The analysis of binomial data by a generalized linear mixed model Biometrika 72, 593-599 Harville DA, Mee RW (1984) A mixed model procedure for analyzing ordered categorical data...

Ngày tải lên: 14/08/2014, 19:22

... appropriate 39 Chapter Generalized Additive Models with Weighted Exponential Families The generalized linear models have been further extended to a larger class of statistical models called generalized ... generalized additive models (GAM) In GAM, the linear predictor of a model is replaced by an additive function of the covariate variables which is not in a parametric form A detailed account of GAM ... See Cook and Martin (1974) and Patil and Rao (1978) Example Another sampling scheme, the line-transect sampling, has been used to estimate the abundance of plants or animals of a particular species...

Ngày tải lên: 16/09/2015, 08:30

... of mathematical models Mathematical Models to describe wastewater treatment process develop very fast these years The task group of IAWQ (International Association of Water Quality) first began ... treatment process Process or units Biological Models Settling Models Influent Anaerobic Models Filtration Models Miscellaneous Models Mathematical Models ASM1, ASM2, ASM2d, ASM3, Mantis, General, ... important to achieve the entire functions of operation control and administration In some WWTPs, wastewater analytical apparatuses and data transferring equipments are collocated sufficiently with...

Ngày tải lên: 05/09/2013, 09:08

... that combined a rapid data acquisition system with an ESR spectrometer (RE-1X, JEOL, Tokyo, Japan) and a stopped-flow system (Ohtsuka Electric Co Ltd., Osaka, Japan) The OH radicals trapped with ... radical generation 1.5-fold that of phenol itself Power law type rate equations are usually adopted to correlate the experimental data in laboratory-scale and pilot-plant scale reactors, and even ... REFERENCES Andreozzi R., Caprio V., Insola A and Marotta R (1999) Advanced oxidation processes (AOP) for water purification and recovery Catal Today, 52, 51-59 Bader H and Hoigne J (1981) Determination...

Ngày tải lên: 05/09/2013, 09:38

... Municipal Hospital wants to place a computer terminal in each patient room, examination room, and operating theater, so patient information will always be available and can be updated immediately ... The Portland office will contain an Enterprise, a Regional, and a Site administrator team Each regional headquarters office will contain both a Regional and a Site administrator team Each district ... emulator application Make a copy of the existing mainframe database and import the copy into the new SQL database Test applications Acceptance criteria: From a Terminal session, users will be able...

Ngày tải lên: 21/12/2013, 04:19

... manuscript and made critical revision to the paper THZ and XHL performed data collection and analysis and helped to draft the manuscript YPZ participated in the data collection, analysis and made critical ... generated after analysis, as follows: The interview was mainly conducted by the principal researcher and assisted by postgraduates The postgraduates were trained to collect data for qualitative ... Data analysis was conducted in Chinese and the final report was translated into English Table 1: Demographic characteristics of the participants Number Gender Male 12 Female 30 Age...

Ngày tải lên: 15/02/2014, 12:20

... chirata joins the growing list of secondary plant metabolites that are derived from an early shikimate derivative as opposed to a pathway via phenylalanine and cinnamate A hypothetical mechanism ... phosphoenolpyruvate unit by decarboxylation of Cambridge Isotope Laboratories (Andover, MA, USA) [U-13C9]Cinnamic acid was prepared by treatment of 13 L-[U- C9]phenylalanine with phenylalanine ammonia-lyase ... intermediary metabolites such as carbohydrate phosphates, pyruvate, and acetyl-CoA via the major glucose utilization pathways (glycolysis and pentose phosphate cycle) Simultaneously, intermediary metabolites...

Ngày tải lên: 08/03/2014, 02:21

... model, we have build another mention classifier on the additional training data, and labeled the original ACE training data with it It is important to note here that the ACE training data (called T ... Maxent models, conditional estimation, and optimization, without the magic Tutorial presented at NAACL-03 and ACL-03 C D Manning and H Sch¨tze 1999 Foundations of u Statistical Natural Language ... English and 200k words for Arabic As mentioned earlier, adding this data to the cascade model is a trivial task: the data just gets added to the training data, and the model is retrained For the AIO...

Ngày tải lên: 08/03/2014, 02:21

... Iran In Geological Association Canada—Mineralogical Association Canada (GAC-MAC) Annual Meeting (Vol 50, p A- 67), Ottawa Hezarkhani, A. , Williams-Jones, A E., & Gammons, C H (1999) Factors controlling ... alteration and mineralization at the Sungun Porphyry Copper Deposit, Iran In Geological Association Canada—Mineralogical Association Canada (GAC-MAC) Annual Meeting (Vol 21, p A- 44), Winnipeg Hezarkhani, ... Threshold

Ngày tải lên: 16/03/2014, 23:20

... about cancer and Hiv & Aids and I like the game because it teaches about aids, cancer and malaria that those things killers and that shows us that our life are important and that you must take care ... and integrating the three clusters of key variables – learning, learner, and instructional game design” Such a position favours a ‘games as tutors’ approach: the technological artifact acts as ... investigate participant cognitive development in this study, but rather to analyse Tool, Object, and Outcome to gaze at collaborative game play 816 Australasian Journal of Educational Technology,...

Ngày tải lên: 22/03/2014, 15:21

... spatial and temporal data, complex analyses, and visualization, (Matejicek, 2002) Due to the ability to manage a number of spatial and temporal data formats, data structures created in the framework ... relational database, so that the geospatial coordinate data of the GIS data layers are stored in the relational data tables Since the relational database supports relationships between its tables, ... values of variables are transferred and incorporated into the GIS database, which can be useful in managing data time series To accommodate large data sets and many variables such as air quality...

Ngày tải lên: 23/03/2014, 02:20

... USA) ANS was from Aldrich Chemical Co., Milwawkee, WI, USA All other reagents were of analytical grade Purification of HSA The higher molecular weight aggregates associated with commercial preparations ... binding site of HSA has space and appropriate shape and residues to accommodate both warfarin and genistein A crystal structure of HSA bound to warfarin is available (PDB no 1h9z and ha2) [16] We used ... the daidzein bound HSA was measured in the presence of warfarin and TIB (bind to domain IIA) and diazepam (marker to domain IIIA, primary fatty acid binding site) Daidzein and HSA, 10 lm each,...

Ngày tải lên: 23/03/2014, 11:20