... Trang 67 SUCCESS PARADIGM FOR PRIVATE UNIVERSITY AS A SOCIAL ENTERPRISE The creation of social value and lasting social impact are indicators of the success of a Social enterprise (Dawans & ... dual mission are Finance Management, Human Resource Management and Marketing Management Adoption of New Managerialism governance mode incorporating market principles towards these aspects along ... an indispensable component of its success paradigm making finance management very important operational aspect The aim of financial management is economic wealth creation leading to social value
Ngày tải lên: 09/07/2020, 02:12
... Trang 1103 Original Article Proposal of a Conceptual Model for Factors Affecting Decisions on Application of Green Practices in Accommodation Establishments - A Case Study in Vietnam National ... Decisions are generally classified into operational decisions – related to the management of day-to-day professional affairs, and strategic decisions – related to long-term organizational policy and ... effectively [64] Chain-affiliated hotels are often large-scale and are multinational corporations, so they have certain advantages in terms of resources as well as the ability to transfer experience,
Ngày tải lên: 28/05/2022, 17:03
A health map for urban planners Towards a conceptual model for healthy, sustainable settlements
... Trang 1A health map for urban plannersTowards a conceptual model for healthy, sustainable relationship between people and their environment with a public health approach which identifies ... criteria and indicators A framework for rational debate and evidence-gathering, in the context of SEA, SA and integrated impact analysis There are of course historic attempts at synoptic planning ... is a move to integrate health impact assessment with environmental and social impact assessment, thus creating an integrated regimefor project appraisal All these changes are so profound as to
Ngày tải lên: 19/10/2022, 03:51
Con Respeto- A Conceptual Model For Building Healthy Community-Un.pdf
... Education Faculty Articles and Research by an authorized administrator of Chapman University Digital Commons For more information, please contact laughtin@chapman.edu Recommended Citation Zavala, ... from 2003-2004 as a program coordinator while a graduate student at UCLA given my familial background; and now as a faculty member in a Chicana and Chicano Studies department at CSUF, I continue ... Program,4 worked in agricultural fields across Arizona, Texas, and California My father toiled in el sacate 5 and later spent decades in the construction industry My maternal and paternal grandmothers
Ngày tải lên: 18/03/2023, 16:39
a theoretical model for the transmission dynamics of the buruli ulcer with saturated treatment
... Trang 1Research ArticleA Theoretical Model for the Transmission Dynamics of the Buruli Ulcer with Saturated Treatment Ebenezer Bonyah,1Isaac Dontwi,1and Farai Nyabadza2 1 Department of Mathematics, ... life expectancy of the human population is 61 years This value has been the approximation of the life expectancy in Ghana [34] and is indeed applicable to sub-Saharan Africa This translates into ... To validate our mathematical anal-ysis results, we plot phase diagrams forR𝑇less than 1 and greater than 1 for the environmental dynamics The global properties of the steady states are confirmed
Ngày tải lên: 02/11/2022, 08:47
mice transgenic for cd4 specific human cd4 ccr5 and cyclin t1 expression a new model for investigating hiv 1 transmission and treatment efficacy
... United States of America, 4 Department of Medicine, University of Alabama at Birmingham, Birmingham, Alabama, United States of America, 5 Birmingham Veterans Affairs Medical Center, Research Service, ... human-specific internal primer sets for CD4 (59 primer: GTGGAGTTCAAAATAGACATCGTG, 39 primer: CAGCACCCACACCGCCTTCTCCCGCTT), CCR5 (59 primer: CACCTGCAGCTCTCATTTTCC, 39 primer: TTGTAGGGAGCCCAGAAGAG) and cyclin ... However, these humanized mouse models cannot take advantage of the wide array of available transgenic and gene-deleted mouse lines to apply Trang 2genetic approaches to investigate HIV-1 transmission
Ngày tải lên: 02/11/2022, 14:24
Success Factors for Mass Customization: A Conceptual Model
... cosmetic changes are Table 1 Levels and approaches of mass customization. Design Collaborative, Transparent Tailor-made products Fabrication Collaborative, Transparent Tailor-made products Assembly ... Trang 1Success Factors for Mass Customization:A Conceptual Model PhD Candidate, University of Groningen, Faculty of Management and Organization, Department of Marketing, P.O Box 800, 9700 AV ... product adaptations Managersmust find an optimal balance between the additional customer value created and theinvestments required to allow customization on a mass scale In order to determine thefeasibility
Ngày tải lên: 02/01/2023, 14:05
The Privatization of Italian Savings Banks – A Role Model for Germany?* doc
... Credito Italiano Credito Romagnolo Banking Group (Emilia Romagna, Bologna), later Rolo Banca 1473 Banca CRT (Cassa di Risparmio di Turino) Cariverona (Cassa di Risparmio di Verona) Cassamarca di ... industriale), which was a public holding company containing the three largest private banks (Banca Commerciale Italiana, Credito Italiano, and Banca di Roma) and a large number of public banks (Körnert ... Trang 1The Privatization of Italian Savings Banks –A Role Model for Germany?* By Elena Carletti**, Hendrik Hakenes and Isabel Schnabel*** Summary: The privatization of the Italian savings banks
Ngày tải lên: 22/03/2014, 21:20
Báo cáo khoa học: "A Bayesian Model for Unsupervised Semantic Parsing" ppt
... evaluate, test, re-solve, determine, investigate 10 nf-kappab, nf-kappa b, nfkappab, nf-kb 11 antiserum, antibody, monoclonal antibody, ab, an-tisera, mab 12 tnfalpha, tnf-alpha, il-6, tnf Table ... made in our model: for ex-ample, proper modeling of alterations requires joint generation of syntactic realizations for predicate-argument relations (Grenager and Manning, 2006; Lang and Lapata, ... MI USA. Nathanael Chambers and Dan Jurafsky 2009 Unsu-pervised learning of narrative schemas and their par-ticipants In Proc of the Annual Meeting of the As-sociation for Computational Linguistics
Ngày tải lên: 23/03/2014, 16:20
Team Risk Management: A New Model for Customer- Supplier Relationships doc
... Integrated management • Making risk management an integral and vital part of project management • Adapting risk management methods and tools to a project’s infrastructure and culture Trang 12SEI ... administrators itmay mean ‘quality assurance.’ To safety professionals it is reducingaccidents and injuries [Kloman 90, p 20] Kloman Paraphrase of Rowe Risk management is a discipline for living ... 8].Kloman summarized the meaning of risk management in the context of a number of different disciplines in an article for Risk Analysis: What is risk management? To many social analysts, politicians,
Ngày tải lên: 23/03/2014, 23:21
Synchronizing Gender Strategies: A Cooperative Model for Improving Reproductive Health and Transforming Gender Relations pot
... and imbalance of power as a means of reaching health as well as gender- equity objectives. Gender-transformative approaches encourage critical awareness among men and women of gender roles and ... The Campaign promotes the idea that every man has a role to play, that each man can create a better, more equitable, and more just world The Campaign promotes this goal through a variety ... integration into new and rewarding territory: the adoption of gender synchronization as a practical approach that will make programs that challenge harmful gender norms—gender transformative
Ngày tải lên: 28/03/2014, 14:20
Báo cáo " A numerical model for the simulation of wave dynamics in the surf zone and near coastal structures " pot
... Trang 1A numerical model for the simulation of wave dynamics in the surf zone and near coastal structures Vu Thanh Ca* Center for Marine and Ocean-Atmosphere Interaction Research, Vietnam ... observed values of various wave characteristics, it can be remarked that the numerical model can simulate wave transformation in the nearshore region with an acceptable accuracy. ... numerical model can satisfactorily simulate the wave transformation, including wave breaking, wave runup on the beach, and turbulence generated by wave breaking and shear. As
Ngày tải lên: 28/03/2014, 15:20
Báo cáo khoa học: A kinetic model for the burst phase of processive cellulases pptx
... Materials and methods All mathematical analysis and numerical fitting were performed using the software package Mathematica 7.0 (Wolfram Research, Inc Champaign, IL, USA) The substrate in the calorimetric ... n units are available for enzy- matic hydrolysis. This interpretation of obstacles and processivity is similar to that recently put forward by Jalak & Valjamae [14]. A kinetic treatment of ... nm 2 for Cel7A [34], we find an S 0 :E 0 area ratio (total available substrate area divided by monolayer coverage area of the whole enzyme popula- tion) which is an order of magnitude smaller
Ngày tải lên: 28/03/2014, 23:20
báo cáo hóa học: "Impact of chronic Immune Thrombocytopenic Purpura (ITP) on health-related quality of life: a conceptual model starting with the patient perspective" potx
... Currently approved medical treatments for ITP can cause major adverse reac-tions [14] For instance, rituximab infusions may cause chills, fever, or severe anaphylactoid reactions [2]; dana-zol is associated ... clinical manifestations of ITP and its management affect patients' everyday activities and well-being Our research aimed to propose a conceptual model that describes the impact of ITP and its treatments ... that has since been val-idated [17,18] For each focus group, patients were recruited at a local academic-based tertiary care center The study protocol was prepared and approved by a cen-tral
Ngày tải lên: 18/06/2014, 22:20
Báo cáo hóa học: " Development of a mathematical model for predicting electrically elicited quadriceps femoris muscle forces during isovelocity knee joint motion" potx
... length A was found to vary in a parabolic manner and was modeled as A(θ) = a(40 - θ)2 + b(40 - θ) + A40, (11) where A40 is the value of A at 40° of knee flexion, and a and b are constants that need ... motor A40 N/ms scaling factor for force at 40° of knee flexion a N/ms-deg 2 scaling factor to account for force at each knee flexion angle b N/ms-deg scaling factor to account for force at each ... calcu-lated for each subject The experimentally measured and model's predicted force-time integrals and peak forces were averaged across six subjects at each velocity and at each stimulation pattern
Ngày tải lên: 19/06/2014, 08:20
báo cáo hóa học: " A cost model for optimizing the take back phase of used product recovery" docx
... the take back process and provide significant insights for analyzing and also managing the take back process. Model We consider three important aspects of take back in our model: the financial ... impractical. In this section we rationalize a simple model for mte without further empirical validation. Alternative models may be used based on empirical data. Ghoreishi et al. Journal of Remanufacturing ... RESEARCH Open Access A cost model for optimizing the take back phase of used product recovery Niloufar Ghoreishi 1* , Mark J Jakiela 1 and Ali Nekouzadeh 2 Abstract Taking back the end-of-life
Ngày tải lên: 21/06/2014, 02:20
báo cáo hóa học:" Research Article A Formal Model for Performance and Energy Evaluation of Embedded Systems" pot
... estimation A tool, named PECES, was implemented for automatizing the method Additionally, a measuring platform, named AMALGHMA, was constructed for characterizing the platform and for comparing ... The AMALGHMA (Advanced Measurement Algorithms for Hardware Architectures) tool has been implemented for automating the measuring activities AMALGHMA adopts a set of statistical methods, such as ... model a real platform, namely, NXP LPC2106, and a theoretical multiprocessor platform The high level of abstraction of the proposed models allows for fast but accurate estimates Additionally, although
Ngày tải lên: 21/06/2014, 11:20
báo cáo hóa học:" Research Article Towards Automation 2.0: A Neurocognitive Model for Environment Recognition, Decision-Making, and Action Execution" docx
... Lab situations as we use today for training systems are not available in the real world It is always an amalgamation of different types of inputs, where relevant information is embedded into a ... perceptual aspects of all modalities are merged An example would be to perceive the visual shape of a person, a voice, and a certain odour and conclude that all this information belongs to a particular ... Taking these concepts as a basis for the development of technical systems appears to be a very reasonable idea: animals and humans have the capability to perceive and (re-)act on their environment
Ngày tải lên: 21/06/2014, 11:20
Báo cáo hóa học: " Research Article A Fluid Model for Performance Analysis in Cellular Networks" doc
... rarely raised in literature: analysis and Monte Carlo simulations can lead to quite different outage probabilities even if analytical average and variance of the underlying Gaussian distribution are ... Given that there are already n, these curves give the probability that a new user, initiating a new call at a given distance, implies an outage As an example, a new user in a cell with already 16 ... for the traditional hexagonal network The simplicity of the result allows a spatial integration of the OCIF leading to closed-form formula for the global outage probability and for the spatial
Ngày tải lên: 21/06/2014, 11:20
Báo cáo hóa học: "Research Article A Markov Model for Dynamic Behavior of ToA-Based Ranging in Indoor Localization" ppt
... Orleans, La, USA, March 2003 [40] N A Alsindi, B Alavi, and K Pahlavan, “Measurement and modeling of UWB TOA-based ranging in indoor multipath environments,” 2007, to appear in IEEE Transactions ... 7.4% obtained from wideband measurement [9, 26] Each state probability can be considered as a random variable Knowing the statistics of the state probability for a certain state, we are able to ... among different classes of ranging errors, back and forth, as it keeps moving Such spatial correlation and change of class can easily be modeled with Markov chains 4.1 Ranging states of the Markov
Ngày tải lên: 22/06/2014, 06:20