a cognitive radio system using discrete wavelet multitone modulation

List the components of a radio system

List the components of a radio system

... components of a radio system ã Describe how different factors affect the design of a radio system ã Explain the radio frequency spectrum 17 Multiple Access (continued) 9 Antennas ã Transmit or ... communication today ã Except for broadcast radio and television ã Half-duplex transmission Sends data in both directions ã But only one way at a time Used in consumer devices such as citizens band ... when receiving the signal ã Attenuation A loss of signal strength ã Multipath distortion As a radio signal is transmitted, the electromagnetic waves spread out 13 Multiple Access (continued) ã Time...

Ngày tải lên: 13/09/2012, 10:52

30 924 0
Tài liệu Báo cáo khoa học: "Using Automatically Transcribed Dialogs to Learn User Models in a Spoken Dialog System" doc

Tài liệu Báo cáo khoa học: "Using Automatically Transcribed Dialogs to Learn User Models in a Spoken Dialog System" doc

... θ be the maximum likelihood estimate using automatically transcribed data, i.e., θ asu = e K D as P a e K D as . This approach ignores transcription errors and assumes that user be- havior depends ... 08540, USA usyed@cs.princeton.edu Jason D. Williams Shannon Laboratory AT&T Labs — Research Florham Park, NJ 07932, USA jdw@research.att.com Abstract We use an EM algorithm to learn user ... expectation and its maximization are easy to compute. This is because our dialog model has a chain-like structure that closely resembles an Hidden Markov Model, so a forward-backward procedure can...

Ngày tải lên: 20/02/2014, 09:20

4 471 0
Tài liệu Báo cáo khoa học: "Paraphrasing Using Given and New Information in a Question-Answer System" docx

Tài liệu Báo cáo khoa học: "Paraphrasing Using Given and New Information in a Question-Answer System" docx

... Reptuentatton in Natural Language Inferenctng', to appear in IJCAI Proceedinqs 79. 13. [KAMAN 79]. Kaplan, S. J., "Cooperative Responses from a Portable Natural Larquage Data Base ... used by the paraphraser to generate questions. I ã INTRO~ION In a natural language interface to a database query system, a paraphraser can be used to ensure that the system has correctly understood ... Pennsylvania, Philadelphia, Pa. 19104 ABSTRACT: The design and implementation of a paraphrase component for a natural language questlon-answer system (CO-OP) is presented. A major point made is the...

Ngày tải lên: 21/02/2014, 20:20

6 536 0
Báo cáo " Development of a spectrometry system Using lock-in amplification technique " doc

Báo cáo " Development of a spectrometry system Using lock-in amplification technique " doc

... Key board, display board, Analog Input board, DSP Logic board and CPU and Power supply board. The DSP logic board takes a digital input from the A/ D converter on the Analog Input board and perform ... spectroscopy has a very important role in studies of optical properties of materials. Our goal is to build a spectrometry system to measure weak optical signals such as Raman scattering and surface SH ... He-Ne laser instead of Ion Argon laser. The Raman excitation by He-Ne laser showed many advantages in comparison with Argon laser excitation. Acknowledgements: This work is supported by the Natural...

Ngày tải lên: 05/03/2014, 14:20

6 524 0
Therapeutic ultrasound as a potential male contraceptive: power, frequency and temperature required to deplete rat testes of meiotic cells and epididymides of sperm determined using a commercially available system doc

Therapeutic ultrasound as a potential male contraceptive: power, frequency and temperature required to deplete rat testes of meiotic cells and epididymides of sperm determined using a commercially available system doc

... GraphPad Prism version 5.0 d, GraphPad Software, San Diego California USA [6]. If data failed Bartlett’s test for equal variances, significance was evalu- ated usi ng the Kruskal-Wallis test and ... determined using a commercially available system James K Tsuruta 1* , Paul A Dayton 3 , Caterina M Gallippi 3 , Michael G O’Rand 1,2 , Michael A Streicker 4 , Ryan C Gessner 3 , Thomas S Gregory 3,6 , ... counts and motilities. Untreated, retired breeders served as untreated controls. Sham-treated animals underwent all preparations for ultrasound treatment as treated animals: anesthesia was administered...

Ngày tải lên: 05/03/2014, 17:20

15 968 0
Báo cáo khoa học: "A Speech-based Just-in-Time Retrieval System using Semantic Search" doc

Báo cáo khoa học: "A Speech-based Just-in-Time Retrieval System using Semantic Search" doc

... Search Andrei Popescu-Belis, Majid Yazdani, Alexandre Nanchen, and Philip N. Garner Idiap Research Institute Rue Marconi 19, CP 592 1920 Martigny, Switzerland {apbelis,myazdani,ananchen,pgarner}@idiap.ch Abstract The ... semantic relatedness using Wikipedia. In AAAI 2006 (21st National Conference on Artificial Intelligence), pages 1419–1424, Boston, MA. Majid Yazdani and Andrei Popescu-Belis. 2010. A ran- dom walk ... information about it. 4.5 The User Interface (UI) The main goal of the UI is to make available all information produced by the system, in a config- urable way, allowing users to see a larger or smaller amount...

Ngày tải lên: 07/03/2014, 22:20

6 381 0
Báo cáo khoa học: "A Chinese-English Organization Name Translation System Using Heuristic Web Mining and Asymmetric Alignment" pot

Báo cáo khoa học: "A Chinese-English Organization Name Translation System Using Heuristic Web Mining and Asymmetric Alignment" pot

... Multilingual and Mixed-language Named Entity Recognition Masaaki Nagata, Teruka Saito, and Kenji Suzuki. 2001. Using the Web as a Bilingual Dictionary. In Proc. of ACL 2001 Workshop on Data-driven ... Organization Name Translation System Using Heuristic Web Mining and Asymmetric Alignment Fan Yang, Jun Zhao, Kang Liu National Laboratory of Pattern Recognition Institute of Automation, ... in Machine Translation. David Chiang. 2005. A hierarchical phrase-based model for statistical machine translation. In Proc. of ACL 2005. Conrad Chen, Hsin-His Chen. 2006. A High-Accurate...

Ngày tải lên: 08/03/2014, 00:20

9 373 0
Báo cáo khoa học: "A Statistical Spoken Dialogue System using Complex User Goals and Value Directed Compression" pptx

Báo cáo khoa học: "A Statistical Spoken Dialogue System using Complex User Goals and Value Directed Compression" pptx

... user goals adopted to make sys- tems computationally tractable. Work in dialogue system evaluation, e.g. Walker et al. (2004) and Lemon et al. (2006), shows that real user goals are generally sets ... our knowledge such a combination of goals with dif- ferent attribute values cannot be straightforwardly handled by comparable state-of-the-art statistical SDSs which appear in the literature. Crook and Lemon ... observation probabilities, and R is the reward function. Since it iteratively projects the rewards associated with each state and action using the state transition and observation proba- bilities,...

Ngày tải lên: 08/03/2014, 21:20

5 332 0
Building a Blog System using Yii pot

Building a Blog System using Yii pot

... GET[’tag’]); $dataProvider=new CActiveDataProvider(’Post’, array( ’pagination’=>array( ’pageSize’=>5, ), ’criteria’=>$criteria, )); $this->render(’index’,array( ’dataProvider’=>$dataProvider, )); } In ... 27 ’users’=>array(’@’), ), array(’deny’, // deny all users ’users’=>array(’*’), ), ); } The above rules state that all users can access the index and view actions, and authenti- cated users can access ... create and update Operations The create and update operations are very similar. They both need to display an HTML form to collect user inputs, validate them, and save them into database. The main...

Ngày tải lên: 10/03/2014, 17:20

62 847 1
Báo cáo khoa học: Construction of a novel detection system for protein–protein interactions using yeast G-protein signaling pdf

Báo cáo khoa học: Construction of a novel detection system for protein–protein interactions using yeast G-protein signaling pdf

... GGGGCTCGAGGTTTTATATTTGTTGTAAAA 25 ATATTATATATATATATAGGGTCGTATATA 26 AAATTATAGAAAGCAGTAGA TAAAACAATG 27 CTTCGAAGAATATACTAAAAAATGAGCAGG CAAGATAAACGAAGGCAAAGTTCAATTCA TCATTTTTTTTTTATTCTTTT 28 GGAGCCATAATGACAGCAGT Detection ... TTCCGAATTCTCATTTACCCGGAGACAGGG 15 CCCCGCGGCCGCTGACACCGATTATTTAAA 16 TTTTGAGCTCGGAGCCATAATGACAGCAGT 17 TTTTGTCGACATGGCGCAACACGATGAAGC CGTAGACAAC 18 GGGGGGATCCTTACATAAGCGTACAACAAA CACTATTTGATTTCGGCGCCTGAGCATCA TTTAGCTTTTT 19 ... plasmids and yeast strains. Primer number Sequence (5Â-to3Â) 1 GCCCGTCGACATATTATATATATATATAGG 2 CCCGCTCGAGTCTTAGAATTATTGAGAACG 3 GCCCGGATCCTGATAGTAATAGAATCCAAA 4 CCCCGAATTCAAATTATAGAAAGCAGTAGA 5...

Ngày tải lên: 16/03/2014, 01:20

9 444 0
Báo cáo khoa học: Identification of sodium salicylate as an hsp inducer using a simple screening system for stress response modulators in mammalian cells pptx

Báo cáo khoa học: Identification of sodium salicylate as an hsp inducer using a simple screening system for stress response modulators in mammalian cells pptx

... Pharmaceutical University, 5 Nakauchi-cho, Misasagi, Yamashina-ku, Kyoto 607-8414, Japan. Fax: + 81 75 595 4758, Tel.: + 81 75 595 4653, E-mail: hatayama@mb.kyoto-phu.ac.jp Abbreviations: SA, ... arachidonic acid to prostaglandins [9] and inhibition of the activation of transcription factor nuclear factor-kappa B [10], have been made to describe how SA exerts its anti-inflammatory effects and also ... heat shock proteins such as Hsp10 5a and Hsp70 in various mammalian cells. Enhancement of thermoresistance of cells by SA Upon exposure to a sublethal heat treatment, mammalian cells acquire transient...

Ngày tải lên: 17/03/2014, 10:20

8 471 0
Using iOS 5: Your Guide to a Great Mobile System

Using iOS 5: Your Guide to a Great Mobile System

... it means that it can get a lot of information for you. You can search for a type of place (Italian restaurants, for example) or a specific location, and Siri can show it to you on a map. Siri also talks ... date, regardless of which list they’re in. Safari Safari is by and large the same browser that you know and love (or hate) – iOS 5 hasn’t changed it a whole lot. Having said that, there are a ... or any details that you might enter. You can enable it from the Safari section of Preferences. Once activated the Safari app changes from blue to black. Finally, the iPad and iPad 2 have finally...

Ngày tải lên: 19/03/2014, 23:44

52 359 0
DISCRETE WAVELET TRANSFORMS - A COMPENDIUM OF NEW APPROACHES AND RECENT APPLICATIONS pdf

DISCRETE WAVELET TRANSFORMS - A COMPENDIUM OF NEW APPROACHES AND RECENT APPLICATIONS pdf

... Chakravarty, Rajkumar Patra and Rohit Raja Chapter 6 Density Estimation and Wavelet Thresholding via Bayesian Methods: A Wavelet Probability Band and Related Metrics Approach to Assess Agitation and ... Transforms Techniques 27 Awad Kh. Al-Asmari and Farhan A. Al-Enizi Chapter 3 DWT Based Resolution Enhancement of Video Sequences 45 Sara Izadpanahi, Cagri Ozcinar, Gholamreza Anbarjafari and Hasan Demirel Section ... Tilendra Shishir Shishir Sinha, Rajkumar Patra, Rohit Raja, Devanshu Chakravarty, Irene Lena Hudson, In Kang, Andrew Rudge, J. Geoffrey Chase, Gholamreza Anbarjafari, Hasan Demirel, Sara Izadpenahi,...

Ngày tải lên: 23/03/2014, 03:20

232 422 0
w