... to the 3GPP-LTE specifications for a typical urban area. Trang 7According to the 3GPP-LTE system, the eNode-B is theone that for each TTI (in our case channel realization) acquires the data about ... typical case for the urban area was utilized for this purpose The time delay and the corresponding average powers in the case of a 12 tap configuration are shown in Table 2 The 3GPP-LTE normative ... the lower bound In this regard, although it may seem that the search tree algorithmand the PBHM could have a similar perfor-mance, a very important aspect to consider is that in the case of the
Ngày tải lên: 21/06/2014, 00:20
... Zhang et al [4] used an approach which takes advantage of the users by selecting an area of interest in the image The selected part of the image is then recognized and translated, with the transla-tion ... reader for the blind The K-NFB Reader [2] is the most comparable device in terms of functions and technical approach Combining a digital camera with a personal data assistant, this technical aid ... color spaces as Abadpour and Kasaei [14] who used a PCA-based fast segmentation method for color spotting Garcia and Apostolidis [15] exploited a char-acter enhancement based on several frames of
Ngày tải lên: 22/06/2014, 19:20
A FUNCTIONAL-ANALYTIC METHOD FOR THE STUDY OF DIFFERENCE EQUATIONS EUGENIA N. PETROPOULOU AND potx
... nonlinear operator equation in an abstract separable HilbertH or Banach H1space Then, after some manipulations, we bring the linear operator equation into the form whereu ∈ H is the unknown variable, ... method, the linear or nonlinear difference equation under consideration is transformed equivalently into a linear or nonlinear operator equation defined in an abstract Hilbert spaceH or Banach spaceH1, ... The aim of this paper is to present the generalization of this functional-analytic method for the study of linear and nonlinear partial difference equations of p variables in the Hilbert space2
Ngày tải lên: 23/06/2014, 00:20
Báo cáo toán học: "A Beurling-Lax theorem for the Lie group U(m,n) which contains most classical interpolation theory " pot
... product) invariant The linear fractional parameterization and the test for existence was obtained for 7 =: 0 or for m =n = 1 by Adamjan, Arov and Krein [1], [2] The test for exis- tence was obtained ... invariant and #-maximal negative Any /#/-maximal nega- tive subspace must contain /# 0.4’; since G is also invariant, it follows that A” c & Since G is a negative space and / is a null space ... vein the forthcoming articles [8], [9] deal with the clas- sical Lie groups (other than U(m,n)) We prove a Beurling-Lax theorem for them and give applications to mathematics and to theoretical
Ngày tải lên: 05/08/2014, 15:20
Báo cáo toán học: " A Specht Module Analog for the Rook Monoid" pot
... well as an analog of Schur-Weyl duality for R n , and Halverson et al.[1] have found an R n analog of the Murnaghan-Nakayama rule, a combinatorial construction of the irreducible characters of ... combinatorics 9 (2002), #R2 2 The Ferrers diagram for the empty partition is denoted by ∅.Ifλ r,wesaythata tableau of shape λ,oraλ-tableau, is a Ferrers diagram of shape λ with the boxes filled with ... of shape λ is in fact a tableau of shape λ.Thecontent of an λ n r -tableau t is the set of entries in t.Ann-tableau t of shape λ is standard if the entries in its rows and columns increase left-to-right
Ngày tải lên: 07/08/2014, 06:23
Báo cáo y học: "A standardized scoring method for the copy of cube test, developed to be suitable for use in psychiatric populations" pdf
... concentrate enough This includes the following four series’ of letters: LTPEAOAISTDA-LAA, ANIABFSAMPZEOAD, PAKLATSXTOEABAA and ZYFMTSAHEOAAPAT The first and third group include five ‘A’s, while the ... (Positive, Negative and General Psychopathology scales), the YMRS and the MADRS are shown in Table 4 The results of the factor analysis (varimax normalized rotation) are shown in Table 5 The analysis ... standard deviations for each SCCT item and total score for the rating and re-rating as well as the respective plots and plots of differ-ence vs average value for each variable suggested that the
Ngày tải lên: 09/08/2014, 01:21
Báo cáo y học: "Left ventricular diastolic dysfunction of the cardiac surgery patient; a point of view for the cardiac surgeon and cardio-anesthesiologist" pptx
... early in diastole by a high E wave The second phase is due to the left atrial contraction, takes place during late diasto-lic phase, and leads to late LV filling depicted by the wave A of transmitral ... diagnosed, esti-mated and graded by using Trans Oesophageal Echo (TOE) Moreover, valuable information may be obtained with the additional use of a Swan-Ganz catheter [33,34,39] According to Ranucci [44], ... that DD was characterized by a decrease in E wave veloc-ity, prolongation of the E wave DT, and a decrease of E/A ratio [43] Potential implicated mechanisms are those of free oxygen radicals, altered
Ngày tải lên: 10/08/2014, 10:20
báo cáo khoa học: " Analysis of a c0t-1 library enables the targeted identification of minisatellite and satellite families in Beta vulgaris" ppt
... TGTGACTTGTAACATTGCGCGGGTGCTTGGCACCATTTGCGTTACCTCAAA AAGCCTTTGAACACCCCAATTATTCATTTCTCGCGAAATCCAAAATTGCCT CGAAATGAACGTAAAGGCATCCACATATTTGTTCCAAGCCACATGACTCCT TTACATTGACCTCCTATGTCCCTAGGAGGCATCCCGTGCCATTTGGAGCTC ... ATAATCATACCTCTATGCCTATTCCAAGTTCTAATGGCTAATGCAAGTCCT AAAATACTCATTTAAACTTTCTACTACATGGTTGTAAGATTCTAAGCAAGT TTAATACACTTAGCCAATTAAAATGAGAAAAACTAAGCCATTTCGAGCCGT TTTTTGGGTTTCATGTTCCT HinfI-satellite 325 2 45 75 - 86 DX982322 TGTGACTTGTAACATTGCGCGGGTGCTTGGCACCATTTGCGTTACCTCAAA ... AGAAGTATACAAGAACATTAATCAAAATATATAAACAAA BvMSat03 40 3 33 55 - 100 ED024452 GTCTCTAAAGCCATGTATTTAGCGTCACATGAATTTAGTT BvMSat10 51 3 24 78 - 100 DX980914 GTTTGTTCTTAAAAGGTTGTTCTTGAATTATTATTCAAGTGTTTGGAAAGA
Ngày tải lên: 12/08/2014, 03:21
báo cáo khoa học: " Cupin: A candidate molecular structure for the Nep1-like protein family" ppt
... AAX12401 and AAX12403 [18] Phytophthora parasitica AAK19753 •• [6] Phytophthora sojae AAM48170 •• (PsojNIP), AAM48171 and AAM48172 [19] Pythium aphanidermatum AAD53944 •• (PaNie234) [20] Bacteria Bacillus ... an auxin-inducing phase that causes malforma-tion and an auxin-depleting secondary phase that kills the host [35] Kilaru et al reported that the increase in auxin coincided with the phase transition ... was delivered to the apoplast However, Bae et al have shown that NEP1 in the plant was localized at the cell wall and cytosol This result indicates that NEP1 can penetrate through the plasma
Ngày tải lên: 12/08/2014, 05:20
Báo cáo sinh học: " A tree-based method for the rapid screening of chemical fingerprints" potx
... bit. In fact we only demand that the data is arranged in some binary tree. The match-bits of a given node are com- puted as all bits that are not a match-bit in any ancestor and for which all fingerprints ... fingerprints in the database, and the average query time is presented. Figure 11 Fraction of coefficients calculated, different database size. The fraction of the database for which the Tanimoto coefficient ... data structures in the buckets. Again, our experiments clearly demonstrate that this leads to a sig- nificant performance increase. Our methods allow researchers to search larger data- bases faster
Ngày tải lên: 12/08/2014, 17:20
Báo cáo y học: " Identification of a novel motif responsible for the distinctive transforming activity of human T-cell leukemia virus (HTLV) type 1 Tax1 protein from HTLV-2 Tax2" pps
... HTLV-4 are associated with any particular disease such as leukemia The amino acid sequence and the functional analysis of HTLV-3 Tax3 showed that Tax3 has a functional PBM, and is capable of interacting ... Shoji†1,2, Masaya Higuchi†1, Rie Kondo1, Masahiko Takahashi1, Masayasu Oie1, Yuetsu Tanaka3, Yutaka Aoyagi2 and Masahiro Fujii*1 Address: 1Division of Virology, Niigata University Graduate School ... 80 80 Transformation (Number) 60 40 20 40 20 Tax 224 Tax 232 Tax Tax 300 Tax2B Tax2B Tax 207 Tax300 D) Tax 154 Tax232 Tax1 Tax224 Tax 207 Tax207 Tax 184 Tax184 Tax154 Tax1 Tax1 Tax 154 Tax207 B)
Ngày tải lên: 12/08/2014, 23:22
Báo cáo y học: "Using the intervention mapping protocol to develop a community-based intervention for the prevention of childhood obesity in a multi-centre European project: the IDEFICS intervention" pptx
... of an organisational structure at the community level stimulate collaboration across different agenda’s; technical assistance on action and strategic planning (module 1) Policy and media advocacy ... of an organisational structure at the school level; stimulate collaboration across different agenda’s; technical assistance on action and strategic planning (module 4) Facilitation Changes in the ... steps, the evalua-tion design was already defined by the start of the Eur-opean project. The process evaluation was developed by the main coordinating center as soon as agreement about the intervention
Ngày tải lên: 14/08/2014, 08:20
Báo cáo sinh học: "A microsatellite-based analysis for the detection of selection on BTA1 and BTA20 in northern Eurasian cattle (Bos taurus) populations" doc
... chromosomal and genomic locations, as well as population and basic statistics, are available in Table 1 Microsatellite variability measures and test for linkage disequilibrium Microsatellite variability, ... divergence at SOD1 and AGLA17 Our data also indicate significant intergenic linkage disequilibrium around the candidate loci and suggest that hitchhiking selection has played a role in shaping the pattern ... populations (Eastern Finncattle, Western Finncattle and Northern Finncattle) It has the advantage of being able to take into account a wide range of potential parameters simultaneously and giving
Ngày tải lên: 14/08/2014, 13:21
Designing a British studies syllabus for the third - year English major at Foreign Language Department, Nghe An teachers' Training College = Thiết kế chương trì
... Vietnam have made endless effort to advance the quality of teaching and learning English for the different purposes It is evident that the study of language cannot be separated from the study of the ... needs and the fact of teaching and learning for the third-year English majors at Foreign Languages Department, Nghe An Teachers’ Training College IV Methods of the study Then, the study used quantitative ... 72) A universal definition for "syllabus" therefore seems impractical, since different educational theories and approaches differ on syllabus goals and functions What can be said is that syllabi
Ngày tải lên: 28/03/2015, 09:17
A Reliable Randomized Algorithm for the Closest-Pair Problem (DUPLICATE GROUPING)
... domain is linear Thereforethe whole algorithm requires linear time and space and it is exponentiallyreliable because all the subroutines used are exponentially reliable Trang 12Whereas the hashing ... few random bits.Further, the analysis of the algorithm is extended to cover the case of Žrepeated input points Rabin’s analysis was based on the assumption that .all input points are distinct The ... integers in a fixed range, and that the distance measure is the standard Euclideanmetric w x In his seminal paper on randomized algorithms, Rabin 27 proposed analgorithm for solving the closest-pair
Ngày tải lên: 21/04/2015, 15:39
Tài liệu Báo cáo khoa học: A systems biology approach for the analysis of carbohydrate dynamics during acclimation to low temperature in Arabidopsis thaliana doc
... Heyer AG (2010) Mathematical modelling of the central carbohydrate metabolism in Arabidopsis thaliana reveals a substantial regulatory influence of vacuolar invertase on whole plant carbon metabolism ... to the measured leakage values with graphpad prism software Gas exchange measurement Exchange rates of CO2 were measured with an infrared gas analysis system (Uras G; Hartmann & Braun AG, Frankfurt ... of the reduced cosubstrate NADPH For isomerization of fructose 6-phosphate, phosphoglucoisomerase was added 516 Mathematical modelling, parameter identification and simulation A mathematical model...
Ngày tải lên: 14/02/2014, 22:20
Tài liệu Báo cáo khoa học: a-Conotoxins as tools for the elucidation of structure and function of neuronal nicotinic acetylcholine receptor subtypes doc
... acts at somatodendritic nAChR in the substantia nigra pars compacta and at presynaptic nAChR in the striatum (B) a- Conotoxin MII was one of the first antagonists that differentiated pharmacologically ... ease of synthesis, makes AuIB is present in intracardiac ganglia, or that the a3 b4* them particularly useful templates for the design of receptors in intracardiac ganglia form a substantially optimized ... ligand-binding domain of the a6 subunit and the transmembrane and intracellular domains of the a3 subunit was used in this study PIA selectively blocks rat and human nAChRs that contain a6 b2 interfaces...
Ngày tải lên: 19/02/2014, 12:20
Đề tài " A five element basis for the uncountable linear orders " doc
... In particular if X is a set of reals of cardinality ℵ1 , then X serves as a single-element basis for the class of uncountable separable linear orders PFA is a strengthening of the Baire Category ... an equivalent formulation due to Bagaria [2]: BPFA: If φ is a formula in language of H(ℵ+ ) with only bounded quantifiers and there is a proper partial order which forces ∃Xφ(X), then H(ℵ+ ) already ... for applying PFA which may be relevant to solving other problems I would like to thank Ilijas Farah, Jean Larson, Paul Larson, Bill Mitchell, and Boban Veliˇkovi´ for carefully reading the paper...
Ngày tải lên: 06/03/2014, 08:21
NATIONAL REPORT OF MALAYSIA ON THE FORMULATION OF A TRANSBOUNDARY DIAGNOSTIC ANALYSIS AND PRELIMINARY FRAMEWORK OF A STRATEGIC ACTION PROGRAMME FOR THE BAY OF BENGAL potx
... Singapore The Straits of Malacca The Straits of Singapore The Straits of Singapore The Straits of Malacca The South China Sea The South China Sea The Straits of Singapore The Straits of Malacca The ... the Earth (Sahabat Alam Malaysia), World Wildlife Fund for Nature (Malaysia), Malaysian Institute of Marine Affairs (MIMA), Malaysian Nature Society, Malaysian Fisheries Society, Environmental ... the Straits of Malacca and the adjacent waters of the Andaman Sea and the Indian Ocean In the process, an attempt is made to identify, examine, and rank those threats that have transboundary effects...
Ngày tải lên: 06/03/2014, 15:21