a challenge for high throughput screening

... Mairal T, Cengiz Ozalp V, Lozano Sanchez P, Mir M, Katakis I, O’Sullivan CK: Aptamers: molecular tools for analytical applications Anal Bioanal Chem 2007, 390:989-1007 Dausse et al Journal of Nanobiotechnology ... 1536-well plate format In addition, as the SELEX can be run simultaneously against a mixture of targets and the AlphaScreen ® analysis can be carried out against individual targets this predicts an increased ... the automated workstation For each SELEX, μM of the RNA library was heated at 80°C for min, cooled at 4°C for min, placed at room temperature for and mixed DNA primers and the biotinylated DNA anchor...

Ngày tải lên: 11/08/2014, 00:23

... neuroblastoma signature, 191 wells: 99.5% accuracy; data not shown) Taken together, these data indicate that LMF represents a highly accurate signature analysis method that is suitable for high- throughput ... BADGE or RASL/DASL nor existing microarray products are amenable to a comparable high- throughput implementation at any cost deposited research basal and low differential expression classes (Figure ... Additional data file 6); a document containing raw LMF data used to assess the stability of the LMF method (in the tab-delimited txt file format; Additional data file 7); and a document containing raw...

Ngày tải lên: 14/08/2014, 16:21

... operates AxioVision via its optionally available Visual Basic for Applications (VBA) interface This script program also provides a graphical user interface where the experimenter parametrizes and ... vector is adapted by nonlinear transformations in advance As an example, consider incorporating the object's perimeter P and area A For a given object, both features are related nonlinearly by A ~ ... [25] We randomly partitioned the data set and used one half for training the classifier and the other half for testing To obtain a stable informational value, this partitioning, training, and testing...

Ngày tải lên: 12/08/2014, 05:20

... MasterScan: a database of shotgun mass spectra The MasterScan is a flat file database that stores all mass spectra acquired from all analyzed samples, including technical and biological replicates, ... available for testing local installations of the software LipidXplorer benchmarking: the dataset E coli total lipid extract was purchased from Avanti Polar Lipids (Alabaster, AL, USA) and analyzed ... demonstrated that LipidXplorer takes full advantage of the high mass resolution and mass accuracy of a hybrid tandem mass spectrometer It has also become apparent that averaging and alignment of related...

Ngày tải lên: 09/08/2014, 22:23

... Baba M, Nishimura O, Kanzaki N, Okamoto M, Sawada H, Iizawa Y, Shiraishi M, Aramaki Y, Okonogi K, Ogawa Y, Meguro K, Fujino M: A small-molecule, nonpeptide CCR5 antagonist with highly potent and ... study and coordinated it All authors read and approved the final manuscript Acknowledgments We thank Sandra Claes and Eric Fonteyn for their excellent technical assistance We also thank Marc Lenjou ... most valuable as a tool for high- throughput evaluation of new CCR5 and CXCR4 inhibitors and in vitro evaluation of their therapeutic potential in combination anti-HIV therapy Materials and methods...

Ngày tải lên: 13/08/2014, 13:20

... will make your local librarian rarer and rarer[Arms 2000] Another fact that also point in that direction is that one of the major costs for classic libraries are staff, facilities and materials, ... research and digital libraries of the future is to handle the increasing automatization of the research sources in a way that makes these resources manageable and available to a broader audience ... European Database on AIDS and HIV infection a bibliographic database focused on grey literature and educational material produced by a group of European documentation centres specialized in AIDS and...

Ngày tải lên: 24/01/2014, 00:20

Ngày tải lên: 21/02/2014, 05:20

... incorporation of 15N and 13C for assignment and interpretation of nuclear magnetic resonance spectra of proteins Q Rev Biophys 23, 1–38 Yamazaki T, Yoshida M, Kanaya S, Nakamura H & Nagayama K (1991) ... obscure the labelling pattern Thus, an early attempt of combinatorial labelling in vivo had to exclude glutamine, glutamate, asparagine and aspartate from the labelling scheme because of excessive ... of samples that need to be prepared and analyzed in order to obtain the same information as that obtained from a much larger set of selectively labelled samples Different combinatorial strategies...

Ngày tải lên: 07/03/2014, 12:20

... Department of Indonesian and Malay, Faculty of Arts, Monash University, Cayton, Victoria Muhadjir (1995) Menjaring Data dari Teks Lembaran Sastra Universitas Indonesia, edisi khusus:Tautan Sastra ... Naomi Sager (1981) Natural Language Information Processing: A Computer Grammar of English and Its Aplications Addison-Wesley Publishing Company, Massachusetts Shelly Shavitri (1999) Analisa Struktur ... Muhadjir, bu Kiswartini, and all of my students who have collaborated with me in these efforts to understand Bahasa Indonesia better References R R Hardjadibrata (1969) An Indonesian Newspaper...

Ngày tải lên: 17/03/2014, 07:20

... typical vacuum-filtration assay design However, both the technical details of performing an assay and the applicability of the assay format are critical to successful automation and high assay throughput ... in SPA format for HTS, it is preferable to first develop a filtration assay The more traditional filtration assay may be used to compare and validate the SPA format, and many of the critical experimental ... et al (15) describes examples of assay optimization through AAO for several type of targets and assay formats A typical optimization process starts with a partial factorial design including many...

Ngày tải lên: 11/04/2014, 09:46

... Bioinformatics for High Throughput Sequencing Naiara Rodríguez-Ezpeleta Ana M Aransay ● Michael Hackenberg Editors Bioinformatics for High Throughput Sequencing Editors Naiara Rodríguez-Ezpeleta ... Genome Analysis Platform CIC bioGUNE Derio, Bizkaia, Spain nrodriguez@cicbiogune.es Ana M Aransay Genome Analysis Platform CIC bioGUNE Derio, Bizkaia, Spain amaransay@cicbiogune.es Michael Hackenberg ... Buenrostro, and Hanlee P Ji 11 Applications of High- Throughput Sequencing Rodrigo Goya, Irmtraud M Meyer, and Marco A Marra 27 Computational Infrastructure and Basic Data Analysis for High- Throughput...

Ngày tải lên: 29/05/2014, 14:33

... parameters Although theoretical analysis alone cannot prove that such transitions are the cause of pathologies in patients, it is apparent that a bifurcation happening in vivo would lead to pathological ... steady state X ∗ in a dynamical system is stable if and only if the real parts of all eigenvalues of the Jacobian are negative In the present model this implies that a given steady state is stable ... class of models which are plausible given the available information Modeling can start from a diagrammatic sketch, which is translated into a generalized model containing unspecified functions Although...

Ngày tải lên: 18/06/2014, 18:20

... individual plates, and the aggregate Z' value from all plates and all days was 0.64 A signal-to-noise value of 4.96 was calculated with the aggregate data from all plates All of the statistical criteria ... Protein Assay (Bio-Rad Laboratories), and 20 μg of nuclear protein was used in the assay Statistical analysis of the data was performed by two-factor ANOVA IL-8 secretion was measured with the Quantikine ... established the assay, performed most of the experiments and assisted in preparation of the manuscript ADB performed a significant number of screening assays and data analysis, and participated...

Ngày tải lên: 20/06/2014, 01:20

... AAAGCCTCACTGTCCTTACACCTAACCAAAAACGGCAGAT GGTGAGAC 00 CTCCACAGA AGCGCCATCATTCCAGTACAAAATTCCCCAGGGCCATTC CCTAGTCCTTTCCACAGCTCTCAAAATTTCCTCACACTC CTCCACAGA 00 GGTGAGAC AGTTGCAGCAGGACTATTCCATTCGCCAAATTTGTCAGGT ... AGTTGCAGCAGGACTATTCCATTCGCCAAATTTGTCAGGT CAAAATAAACCCACTCTTAACTTTTTCAACCAAGCGACATCACTTAAAG 99 CACTTAAAGTTGGTAGTGAAATACACCCAACCAATGCAGCAATTCCTGT Figure Part of the individual IS report This example shows the four ... (For full Iss Candidates) IS ID FLANKING REGION LEFT DR SIZE ? FLANKING REGION RIGHT GAACCTGTAGCCTCTGAAAACACCCTTACTCCCCAATAAATTCATTGAC 10 ATTCATTGACCTAGTTTTTGACAAGAAAGGGGGGCTCGTTTGAGCCCCC AAAGCCTCACTGTCCTTACACCTAACCAAAAACGGCAGAT...

Ngày tải lên: 09/08/2014, 22:24

... extraction postoperative panoramic radiographs after tooth extraction and bone augmentation Figure and bone augmentation postoperative panoramic radiographs after implant setting postoperative panoramic ... iliac alveolar (below) using autogenousmaxilla (above) and the alveolar ridge augmentation of the maxilla (above) and the mandible (below) using autogenous bone grafts from the iliac crest Page ... radiographs showing features of preoperative panoramic radiographs showing features of dentin dysplasia type I ture of rasin and BaSO4) for implant planning was arranged The CT scan showed a high degree...

Ngày tải lên: 12/08/2014, 00:20

... DNA template, 1× PCR buffer (Qiagen, Valencia, California, USA), 0.2 mM each dNTP, 0.4 μM of each primer, U HotStarTaq DNA polymerase (Qiagen, Valencia, California, USA), and water to a final ... Inc., Haan, Germany) and DNA extraction was performed using the DNeasy 96 Plant Mini Kit (Qiagen, Valencia, California, USA) according to the manufacturer's protocol WGA Ten ng of gDNA was amplified ... Recently, significant efforts towards largescale SNP characterisation have been attempted in animals and plants with BeadArray technology (Illumina [7]) and the SNPlex™ genotyping system (Applied Biosystems...

Ngày tải lên: 12/08/2014, 05:20

... Gomersall Critical Care 2010, 14:131 http://ccforum.com/content/14/2/131 that we cannot help As acute care specialists we can contribute to education in acute care as well as intensive care Initiatives ... on behalf of China Critical Care Clinical Trial Group (CCCCTG): Clinical review: Critical care medicine in china mainland Crit Care 2010, 14:206 Depasse B, Pauwels D, Somers Y, Vincent JL: A profile ... European ICU nursing Intensive Care Med 1998, 24:939-945 InFACT [http://www.infactglobal.org/] Global Health Workforce Alliance [http://www.who.int/workforcealliance/en/] World Health Organization:...

Ngày tải lên: 13/08/2014, 20:21