a case study for mobile software development

... a total installed capacity of 721.3 MW (80%) and an average annual energy production of 2,816 GWh (72%), would in that case be economically viable [3] b) Water allocation and conflicting demands ... and Atmospheric-Ocean Global Circulation Models, are used to assess climate change impacts in Lao Cai Province, namely: Baseline scenario using the historical data and simulating the climate ... that may be alleviated by storage capacities of reservoirs; (3) Climate change adaptation related to changes of the hydrological pattern with more pronounced dry periods that may be alleviated...

Ngày tải lên: 13/02/2014, 12:20

... correctly alternate (cause, deliver, hand, refuse, report and set for the dative alternation and cause, spoil, afford and prescribe for the benefactive), and 12 can appear in either frame but not alternate ... acquired 68 for the dative and 43 for the benefactive alternation (in both cases including verbs for which only one frame was acquired) The dative and benefactive alternations were also acquired for ... underlying assumption is that a verb is typical for an alternation if it is equally frequent for both frames which are characteristic for the alternation Thus the typicality of a verb can be defined as...

Ngày tải lên: 20/02/2014, 19:20

... geodatabase, all the data are loaded into the relational database, so that the geospatial coordinate data of the GIS data layers are stored in the relational data tables Since the relational database ... spatial and temporal data, complex analyses, and visualization, (Matejicek, 2002) Due to the ability to manage a number of spatial and temporal data formats, data structures created in the framework ... primary storage in the GIS spatial database serves furthermore for spatial analysis, display and visualization As with the previous data, meteorological data are also preprocessed from the database...

Ngày tải lên: 23/03/2014, 02:20

... TTTCACCTCTGCCTAATCATCTC TTT ACCTCTGCCTAATCATCTC TCTTGTTCCCAAGAATATGGTG GCGTCGCAGAAGATCTCAAT TTGAGAGAAGTCCACCACGAG CTGCTGGTGGCTCCAGTT GCCTTGTAAGTTGGCGAGAA GTATTGGGGGCCAAGTCTGT GTATTGGGGGCCAAATCTGT AAAAAGTTGCATGGTGCTG ... GCCGCGTCGCAGAAGATCTCAATCTC GGGTCACCATATTCTTGGGAACAAGA CCTGCTGGTGGCTCCAGTTC TCCTAGGACCCCTGCTCGTGTT ACTTCTCTCAATTTTCTAGGGGG TATATGGATGATGTGGTATTGGGGGCCAA TTCTCGCCAACTTACAAGGCCTTTCT CACCAGCACCATGCAACTTTTT ORF located in ... genome amplification and fragment amplification Primers WA-L WA-R FA1-L FA1-L' FA1-R FA2-L FA2-R FA3-L FA3-R FA4-L FA4-L' FA4-R Sequence ACTGTTCAAGCCTCCAAGCTGTGC AGCAAAAAGTTGCATGGTGCTGGT TTTCACCTCTGCCTAATCATCTC...

Ngày tải lên: 18/06/2014, 18:20

Ngày tải lên: 18/06/2014, 18:20

... Klabin and Aracruz that present data for years 2003, 2004 and 2005 and Cenibra which data are available only for 2005 ** The companies not have this value calculated All plants, excepting Aracruz and ... indicators lower than Cenibra in all parameters Votorantim, Suzano Bahia Sul, Ripasa and International paper are integrated producers of the writing and printing paper By calculating the average of the ... Brazilian companies and comparing with the international Paper performance, the Brazilian group reaches an average lower than foreign subsidiary in five of the six parameters The values reached...

Ngày tải lên: 22/02/2014, 09:20

... (Ground data, GIS data and satellite imagery data) • The zonation can be regarded as a tool for sustainable agricultural development in the watershed area 17 Suggestion zones for sustainable of watershed ... landscape in the study area has been changed cause of policy implementation such as rubber plantation and irrigation system were installed in the area, and than this place was changed in dynamics ... by created land zoning Materials and Methods Materials • • • • Satellite images: – Landsat ETM+ (25 January 1999), LIG format • Resolution – 30 m (band 1-5,7) – 15 m panchromatic – Landsat ETM+...

Ngày tải lên: 17/03/2014, 11:20

... teachers, and can be employed for animal-assisted therapy (AAT) and animal-assisted activities (AAA) instead of real animals [2] This can partly reduce working strength of the staff, activate learning ... Facial A ect (POFA) databases have shown that the combination of AdaBoost as a feature selection method, SVM as a classification algorithm, and voting as a multiclass decision strategy can obtain ... shown that in human face-to-face communications, 7% and 38% information are transferred by spoken language and paralanguage, and 55% is transferred by facial expressions, we select facial expressions...

Ngày tải lên: 09/09/2015, 10:18

... goals of the Singapore Packaging Agreement.” 3R Packaging Awards 2008 Communication Folder The Singapore Star Award The Asia Star Awards are organised annually by the Asian Packaging Federation ... plans for the continuous development of the country It was created in January 2008 to formulate a national strategy for Singapore’s sustainable development regarding domestic and global challenges ... studied shall be selected from representative cases and each case should serve a particular purpose within the general investigation scope Thus, each case should be analysed and compared based on...

Ngày tải lên: 12/10/2015, 17:36

... provides practical information with reasonable accuracy, which can be used for environmental planning and management Open land use corresponds to low pollutant loads for all water quality parameters ... expression and clear graphical representation that shows relationships among variables A Bayesian network is graphically represented as a directed acyclic graph (DAG) that consists of a set of ... pollutant loads per unit pixel and unit rainfall for each water quality parameter i and α is a normalization factor that depends on units and conversion factors Table Runoff coefficient and EMCs for...

Ngày tải lên: 05/09/2013, 09:08

... at the stage of planning and implementation of water and sanitation options Educational intervention on water and sanitation: 1995-1997 The educational intervention on water and sanitation was ... pollution load to the surrounding water bodies such as a canal and ponds It was partly because the people had considered the biogas plant as maintenance free and they did not any maintenance at all with ... in Bauniabad, staffs of Dhaka Water and Sewerage Authority, staffs of EPRC and all the stakeholders for their kind cooperation and contribution to the study REFERENCES Bangladesh Bureau of Statistics...

Ngày tải lên: 05/09/2013, 09:08

... learning style preferences and needs, planning for an L2 task, gathering and organizing materials, arranging a study space and a schedule, monitoring mistakes, and evaluating task success, and ... Many compensation strategies are used to compensate for a lack of appropriate vocabulary, but these strategies can also be used to make up for a lack of grammatical knowledge Compensation strategies ... there are two influential views: traditional view and alternative view They thought that traditional view was inappropriate and inadequate because the listener was regarded as a tape-recorder and...

Ngày tải lên: 27/12/2013, 20:26

... capital Capital is expressed as the value of all assets managed by the enterprise and used at a certain time There are various meaning of capital According to Jean Murray, “Capital is accumulated ... Finally, cash is needed to management of working capital Cash consists of cash in hand (money) and bank accounts and credits Financial managers manage cash to ensure that it is always available ... calculate criteria related to capital and capital management 35  Realize that capital management involve financial decision  Have an overview of the key financial decision  Appreciate situations...

Ngày tải lên: 13/03/2014, 14:20

... Geological Association Canada—Mineralogical Association Canada (GAC-MAC) Annual Meeting (Vol 21, p A- 44), Winnipeg Hezarkhani, A. , & Williams-Jones, A E (1998) Controls of alteration and mineralization ... Resources Research, 8(1), 27–35 Dambatta, A B., Farmani, R., Javadi, A A., & Evans, B M (2009) The Analytical Hierarchy Process for contaminated land management Advanced Engineering Informatics, 23, ... Background

Ngày tải lên: 16/03/2014, 23:20

... funding application Moreover, Habib M et al (2008) stated that an integrated approach to achieving campus sustainability has been applied Universities can nowadays be regarded as ‗small cities‘ ... environment clean: - To make sure that the parameters of exhaust, wastewater and noise reach Vietnamese standards; - To manage solid and hazardous waste; - To ensure the work environment clean and airy ... 5937:2005 (Air quality – Ambient air quality standards) and TCVN 5938:2005 (Air quality – Maximum allowable concentration of harzardous substances in ambient air) To collect and treat To collect and...

Ngày tải lên: 22/03/2014, 09:20

... Wa Guinea savannah Northern Salaga Damongo Walewale Guinea savannah Guinea savannah Guinea savannah Brong Ahafo Nkoranza Transition Ashanti Sekyere West Adansi East Amansie West Transition Forest ... Forest Western Dorma-Ahenkro Sefwi Wiaso Mpohor-Wassa Forest Forest Forest Central Gomua-Assin-Ajumako Agona Coastal savannah Coastal savannah Eastern Suhum Kraboa Yilo Krobo West Akim Fanteakwa ... Ghana Grains Development Project Name Aburotia Dobidi Kawanzie Golden Crystal Safita-2 Okomasa Abeleehi Dorke SR Obatanpa Mamaba b Dadaba b Cidaba b Year of release Grain color Grain texture Maturity...

Ngày tải lên: 24/03/2014, 05:20

... Crossman A, Cannings A A social interaction approach to managing the ‘invisibles’ of virtual teams Ind Manage Data Syst J 2004;104(8):502–7 [8] Cascio WF Managing a virtual workplace Acad Manage ... from an external Data Centre in Singapore running a ‘standard’ software application and the other half operating from an ‘owned’ regional Data centre in Germany running a variety of software applications ... requirements and satisfaction, and (3) project team satisfaction and self-assessed success Data was unavailable to evaluate suppliers’ satisfaction and other stakeholders’ satisfaction It could be said...

Ngày tải lên: 29/03/2014, 23:20

Ngày tải lên: 30/03/2014, 01:20