a biometric identification technique for robust security system

báo cáo hóa học: " A game-theoretic architecture for visible watermarking system of ACOCOA (adaptive content and contrast aware) technique" pdf

báo cáo hóa học: " A game-theoretic architecture for visible watermarking system of ACOCOA (adaptive content and contrast aware) technique" pdf

... global variance, the local mean, the local variance, and global covariance The complexity of global mean, global variance, and global covariance are ≈ O(n2) The complexity of local mean and the ... this article as: Tsai and Liu: A game-theoretic architecture for visible watermarking system of ACOCOA (adaptive content and contrast aware) technique EURASIP Journal on Advances in Signal Processing ... sensitivity of parameters between the original image, watermarked image and attacked image can be evaluated by the analysis of variance (ANOVA) technique in order to get the systematic influence values...

Ngày tải lên: 21/06/2014, 00:20

22 394 0
MONOTONE ITERATIVE TECHNIQUE FOR SEMILINEAR ELLIPTIC SYSTEMS A. S. VATSALA AND JIE YANG Received 27 pdf

MONOTONE ITERATIVE TECHNIQUE FOR SEMILINEAR ELLIPTIC SYSTEMS A. S. VATSALA AND JIE YANG Received 27 pdf

... 551–557 A S Vatsala: Department of Mathematics, University of Louisiana at Lafayette, Lafayette, LA 70504-1010, USA E-mail address: vatsala@louisiana.edu Jie Yang: Department of Mathematics, University ... Evans, Partial Differential Equations, Graduate Studies in Mathematics, vol 19, American Mathematical Society, Rhode Island, 1998 G S Ladde, V Lakshmikantham, and A S Vatsala, Monotone Iterative ... Lakshmikantham and S K¨ ksal, Monotone Flows and Rapid Convergence for Nonlinear Paro tial Differential Equations, Series in Mathematical Analysis and Applications, vol 7, Taylor & Francis, London,...

Ngày tải lên: 23/06/2014, 00:20

14 392 0
báo cáo hóa học:" In vivo evaluation of a vibration analysis technique for the per-operative monitoring of the fixation of hip prostheses" pdf

báo cáo hóa học:" In vivo evaluation of a vibration analysis technique for the per-operative monitoring of the fixation of hip prostheses" pdf

... for the mechanical characterization of the primary bone-prosthesis stability In a previous study we demonstrated the feasibility and validity of a vibration analysis technique for the assessment ... stages and canal and reinserting the prosthesis The FRF had a normal evolution during the reinsertion and the graphs corresponding to the final two stages, labelled as stage 4a and stage 5a, are ... been avoided in the case of an abnormal bone structure and a deformed endomedullary canal as the FRF analysis showed an abnormality and the surgeon was alerted to the situation in time during insertion...

Ngày tải lên: 20/06/2014, 01:20

10 544 0
A Visual Retrieval Environment for Hypermedia Information Systems ppt

A Visual Retrieval Environment for Hypermedia Information Systems ppt

... an object database is represented by a graph, and the data manipulation is expressed by graph transformations [Andries et al 1992] This transformation language has a graphical syntax and semantics ... with the data manipulation language expressed in terms of graph transformations Amann and Scholl [1992] presented a graph data model with an associated algebraic language based on regular expressions ... paradigm appears to be superior for hypermedia modeling Of particular interest are graph-based data models since they provide a natural way of handling data that appear in applications such as...

Ngày tải lên: 29/06/2014, 04:20

27 374 0
A Reverse Engineering Technique for Creating Virtual Robots potx

A Reverse Engineering Technique for Creating Virtual Robots potx

... measuring system for digitalization was set on a stiff and stabile portable frame, which enables high quality acquisition of snaps Before shooting, the system was calibrated with a special calibration ... transformation matrix is a product of four simple transformation matrices to Eq (1) holds for rotational joints where θi is the joint variable We put the parameters for the DH notation, for all ... T06 = A1 ⋅ A2 ⋅ A3 ⋅ A4 ⋅ A5 ⋅ A6 = [ a1 a2 a3 a4 ] (10) The elements of the matrix are a1 , a2 , a3 , a4 and they are given in Eqs (11) to (14) The Eq (10) is a solution of the direct kinematic...

Ngày tải lên: 02/08/2014, 09:21

9 358 0
Báo cáo toán học: "A Sperner-Type Theorem for Set-Partition Systems" ppsx

Báo cáo toán học: "A Sperner-Type Theorem for Set-Partition Systems" ppsx

... P has the same cardinality, that is |A| = c, for all A ∈ P If k does n not divide n, a partition P ∈ Pk is said to be almost uniform if every class A ∈ P has |A| = n/k or |A| = n/k n A partition ... largest Sperner partition system in Pk is an almost-uniform partition system For the case where n = ck, where c and k are integers, an almost-uniform partition system is a uniform partition system ... Two subsets A, B are incomparable if A ⊆ B and B ⊆ A A set system on an n-set A is said to be a Sperner set system, if any two distinct sets in A are incomparable Sperner’s Theorem...

Ngày tải lên: 07/08/2014, 08:22

6 206 0
Báo cáo khoa học: " Development of a neuro-fuzzy technique for automated parameter optimization of inverse treatment planning" doc

Báo cáo khoa học: " Development of a neuro-fuzzy technique for automated parameter optimization of inverse treatment planning" doc

... ANFIS and (b) human plan Prostate plan evaluation for (a) ANFIS and (b) human plan The DVHs are shown in (c) ANFIS is displayed as solid lines, plans created by human as dot lines and FIS as dashed ... overall planning time While this approach offers a more systematic method to find a suitable plan than sequential optimization with arbitrarily changed constraints, a Another approach that has already ... Human ANFIS 40 30 Human 20 FIS 10 ANFIS 0 10 20 30 40 50 60 70 80 90 100 110 (c) Figure Brain plan evaluation for (a) ANFIS and (b) human plan Brain plan evaluation for (a) ANFIS and (b) human...

Ngày tải lên: 09/08/2014, 10:20

16 511 0
Báo cáo y học: " A double shunt technique for the prevention of ischaemia of a congenital, solitary, pelvic kidn" pps

Báo cáo y học: " A double shunt technique for the prevention of ischaemia of a congenital, solitary, pelvic kidn" pps

... disastrous renal infarction and subsequent functional impairment Murakami et al also reported a 77-year-old patient with an AAA associated with a CSPK, which was supplied by two aberrant renal arteries ... Endovascular repair of abdominal aortic aneurysms in patients with congenital renal vascular anomalies J Vasc Surg 1999, 30:407-15 Murakami T, Makino Y, Suto Y, Yasuda K: Abdominal aortic aneurysm ... AAA Kaplan et al first presented a patient with a single renal artery arising from the right common iliac artery [7] The AAA was successfully repaired endoluminally with a tube stent graft, and...

Ngày tải lên: 11/08/2014, 00:22

4 313 0
Aneka  a control software framework for autonomous robotic systems

Aneka a control software framework for autonomous robotic systems

... addition to their availability, they also have a few additional advantages that make them especially suited for testing something as generic as a control software framework: They are an inherently ... system used for such a study in this thesis has several qualities that make it a particularly attractive problem area: Robot soccer is a robotic system straightforwardly modelled using a SMPA ... external world and outputs signals in the form of CGrabbedImage The grabbed images are simply an array of RGB pixels that also contain meta-data such as image dimensions and bits per pixel The frame...

Ngày tải lên: 29/09/2015, 13:01

95 348 0
WaterAlternatingGas (WAG) Injection a Novel EOR Technique for Mature Light Oil Fields  A Laboratory Investigation for GS5C sand of Gandhar Field. ENHANCED OIL RECOVERY

WaterAlternatingGas (WAG) Injection a Novel EOR Technique for Mature Light Oil Fields A Laboratory Investigation for GS5C sand of Gandhar Field. ENHANCED OIL RECOVERY

... The basic data used to prepare live oil and calculation of results is annexed as Table 1&2 Water-Alternating-Gas (WAG) Injection a Novel EOR Technique for Mature Light Oil Fields - A Laboratory ... Fluid Saturation -Tapered WAG Figure– 3a : Fluid Saturation -Tapered WAG (Reversed) Figure – 5a : Five cycle WAG with CO2 Gas Water-Alternating-Gas (WAG) Injection a Novel EOR Technique for Mature ... Fluid Saturation – Single cycle WAG Table-3 Figure – 2a : Five cycle WAG with Hydrocarbon Gas Water-Alternating-Gas (WAG) Injection a Novel EOR Technique for Mature Light Oil Fields - A Laboratory...

Ngày tải lên: 19/03/2017, 09:29

7 432 0
Báo cáo hóa học: " A Robust Parametric Technique for Multipath Channel Estimation in the Uplink of a DS-CDMA System" pot

Báo cáo hóa học: " A Robust Parametric Technique for Multipath Channel Estimation in the Uplink of a DS-CDMA System" pot

... Least Squares Problems, o chapter 9, SIAM, Philadelphia, Pa, USA, 1996 [20] A A Rontogiannis, A Marava, K Berberidis, and J Palicot, “Efficient multipath channel estimation using a semiblind parametric ... Moving a step further we show that the inverse MAI covariance matrix can be approximated by a diagonal matrix Indeed, by applying the matrix inversion lemma to (A. 4), and taking into account the approximate ... oversampling factor Q increase As a result, ma(i,i) − trix [Rη ]−1 and accordingly matrix Rη tend to a diagonal − matrix with equal diagonal elements In practice, matrix Rη possesses a “heavy” main...

Ngày tải lên: 22/06/2014, 22:20

12 439 0
Tài liệu Báo cáo khoa học: "Semantic Information and Derivation Rules for Robust Dialogue Act Detection in a Spoken Dialogue System" pptx

Tài liệu Báo cáo khoa học: "Semantic Information and Derivation Rules for Robust Dialogue Act Detection in a Spoken Dialogue System" pptx

... collected for this work The first type of data, called A- data, is a travel information data set harvested from the databases available on the web, e.g., Wikipedia and Google Map A- data consists ... Kashioka, and S Nakamura 200 9a Recent advances in wfst-based dialog system In Proc INTERSPEECH, pages 268–271 C Hori, K Ohtake, T Misu, H Kashioka, and S Nakamura 2009b Statistical dialog management ... historical information, and Ω = {A1 , , Aq } is the set of DAs Using the maximum approximation for summation, (1) can be written as A = arg max t A Ω h (A, Ht ) = P r(At = A | At−1 ) W W = arg max P...

Ngày tải lên: 20/02/2014, 05:20

6 556 0
Radar-Based Intruder Detection for a Robotic Security System Phil Corya, H. R. Everettb, Tracy Heath pptx

Radar-Based Intruder Detection for a Robotic Security System Phil Corya, H. R. Everettb, Tracy Heath pptx

... with a minimum target velocity of 0.1 miles per hour (0.147 feet/second) Have a nuisance alarm rate (NAR) and false alarm rate (FAR) not to exceed one per MDARS-E platform per shift Have an image-assessment ... such as a security breach Any reported exceptional conditions are ranked according to a site-specific prioritization scheme and automatically assigned in appropriate order to an Operator Station ... detect, track, and validate human intruders out to 100 meters with an almost-zero nuisance alarm rate The radar system has performed well in measuring the velocity and distance to targets and detecting...

Ngày tải lên: 22/03/2014, 11:20

11 322 0
Báo cáo sinh học: " CODEHOP-mediated PCR – A powerful technique for the identification and characterization of viral genomes" pptx

Báo cáo sinh học: " CODEHOP-mediated PCR – A powerful technique for the identification and characterization of viral genomes" pptx

... GTGGTCGATTTTGCCAGCCTGTACCCGAGCATCATCCAGGCGCACAACCTGTGC GTAGTAGACTTTGCTAGCCTGTATCCTAGTATTATACAAGCTCATAATCTATGC GTGGTGGACTTTGCCAGCCTGTACCCCACCATCATCCAGGCCCACAACCTCTGC GTAGTGGACTTTGCCAGCCTGTACCCAAGCATTATTCAGGCACACAATCTGTGT GTAGTTGACTTTGCCAGCTTGTACCCCAGCATCATCCAGGCTCATAATCTATGC ... (151aa) CAB61754 (151aa) AAC55648 (55aa) AAD30141 (56aa) AAG23218 (158aa) AAC57974 (151aa) DFASA-GDTD1B AAF23082 (158aa) DFASA-GDTD1B DFASA-GDTD1B DFASA-GDTD1B DFASA-GDTD1B DFASA-GDTD1B DFASA-GDTD1B ... GTTTTTGATTTCCAAAGTTTGTATCCAAGTATTATGATGGCTCATAATCTGTGT RhCMV GTGTTTGACTTTGCCAGCCTGTATCCGTCAATTATCATGGCACATAATCTCTGT RFHVMm GTTGTGGATTTTGCTAGCCTTTATCCCAGCATCATGCAGGCCCACAACCTATGT γ AtHV3 GTAGTAGACTTTGCTAGCCTTTACCCAAGTATTATACAAGCTCATAATCTGTGT...

Ngày tải lên: 18/06/2014, 22:20

24 605 0
Báo cáo hóa học: " Quantification of the effects of an alpha-2 adrenergic agonist on reflex properties in spinal cord injury using a system identification technique" pptx

Báo cáo hóa học: " Quantification of the effects of an alpha-2 adrenergic agonist on reflex properties in spinal cord injury using a system identification technique" pptx

... procedures Parallel cascade system identification model We used a parallel cascade system identification technique to separate reflex and intrinsic contributions to ankle dynamic stiffness This technique, ... the manuscript DC referred the patients and participated in interpreting data, and WZR participated in interpreting data and writing the manuscript All authors read and approved the final manuscript ... manuscript Acknowledgements We wish to acknowledge Krista Settle (DPT), ChengChi Tsao (DSs), and Montakan Thajchayapong (PhD Candidate), for their collaboration in data collec- Mirbagheri et al Journal...

Ngày tải lên: 19/06/2014, 08:20

7 468 0
Báo cáo hóa học: " Research Article A Suboptimal PTS Algorithm Based on Particle Swarm Optimization Technique for PAPR Reduction in OFDM Systems" potx

Báo cáo hóa học: " Research Article A Suboptimal PTS Algorithm Based on Particle Swarm Optimization Technique for PAPR Reduction in OFDM Systems" potx

... an OFDM signal by use of PTS with low computational complexity,” IEEE Transactions on Broadcasting, vol 52, no 1, pp 83–86, 2006 [14] A D S Jayalath and C Tellambura, “Adaptive PTS approach for ... Madhukumar, and F Chin, “Peak-to-average power reduction using partial transmit sequences: a suboptimal approach based on dual layered phase sequencing,” IEEE Transactions on Broadcasting, vol ... 40, we can see that the PSO-based PTS technique is capable of attaining a near OPTS technique performance, when Pr (PAPR > PAPR0 ) = 10−3 In Figure 3, we compare the PAPR performance of different...

Ngày tải lên: 21/06/2014, 23:20

8 407 0
Báo cáo hóa học: " A Technique for Dominant Path Delay Estimation in an OFDM System and Its Application to Frame " docx

Báo cáo hóa học: " A Technique for Dominant Path Delay Estimation in an OFDM System and Its Application to Frame " docx

... of a window of 2M samples R(d) gives an estimate of the energy in M samples of the received signal For a specified SNR, mean and variance of M(d) are analytically evaluated for AWGN channel, and ... the signal arriving through a delayed path may be larger than that of the earliest path In those cases, the estimate of the frame boundary may be shifted by a quantity equal to the delay of the ... was on the Faculty of IIT, Madras, IIT, Kharagpur, Osmania University and Indian Institute of Science (IISc), Bangalore At Osmania University, he established the Research and Training Unit for...

Ngày tải lên: 22/06/2014, 22:20

8 420 0
Báo cáo hóa học: " Design and Realization of a New Signal Security System for Multimedia Data Transmission" ppt

Báo cáo hóa học: " Design and Realization of a New Signal Security System for Multimedia Data Transmission" ppt

... This data-processing rate is fast enough for realtime data protection in multimedia data transmission applications The proposed signal security system is suitable for both software and hardware ... data transformation Then, we exploit a chaotic system in generating a binary sequence to control the bit-circulation functions for performing the successive data transformation on the input data ... matrixes; (2) different matrixes can be transformed into the same matrix; (3) given a transformation pair of M and M , the combination of p, q, r, and s resulting in the transformation pair may...

Ngày tải lên: 23/06/2014, 01:20

15 423 0
w