... from genomic DNA of B xenovorans LB400 through a PCR with GAGCGGCATATGGA AATCAAACCGAAGGTTCGCGA and GAGCGGCATA TGGAAATCAAACCGAAGGTTCGCGA as the forward and reverse oligonucleotide primers, respectively ... metal–ligand distances (Table 2) compare very favorably with data in the protein database, from ˚ which an average distance of 2.03 A for Fe–N(His) was inferred [38], and a target distance of ... participation of Fe2+ as a redox-active cofactor in enzymatic catalysis of oxidative carbon– carbon bond cleavage However, a role of Fe2+ as an essential structural component of the active enzyme cannot...
Ngày tải lên: 18/02/2014, 06:20
... Health Organisation, South East Asian Regional Office (WHO/SEARO), New Delhi on "Health and Social Aspects of the Elderly" We are grateful for the financial assistance provided by the WHO/SEARO ... functional ability of an elderly population in Sri Lanka Table Comparison of informant assessment of health status with self-assessment Self-assessment healthy not healthy n n Informant assessment ... WHO/SEARO and the technical assistance by Professor Gary Andrews, Centre for Aging Studies, Flinders University of South Australia, Adelaide, Australia We wish to thank Dr Joe Fernando Secretary,...
Ngày tải lên: 14/02/2014, 06:20
Tài liệu Báo cáo khoa học: The SCO2299 gene from Streptomyces coelicolor A3(2) encodes a bifunctional enzyme consisting of an RNase H domain and an acid phosphatase domain pdf
... encode a bifunctional enzyme consisting of an RNase H domain and an APase domain The RNase H and APase activities of the full length SCO2299 protein depend on its N-terminal RNase H domain and C-terminal ... 12–19 19 Ohtani N, Yanagawa H, Tomita M & Itaya M (2004) Identification of the first archaeal type RNase H gene from Halobacterium sp NRC-1: archaeal RNase HI can cleave an RNA-DNA junction Biochem ... examined here is a bifunctional enzyme consisting of an RNase H domain and an APase domain, and it is a novel style in the Type RNase H family Experimental procedures Cells, plasmids, and materials...
Ngày tải lên: 19/02/2014, 18:20
Báo cáo Y học: Functional reconstitution of the HIV receptors CCR5 and CD4 in liposomes pot
... 125I-labelled sheep anti-mouse Ig from Amersham Pharmacia Biotech (Saclay, France), anti-CCR5 mAb 2D7 from PharMingen Becton-Dickinson (Le Pont des Claix, France), and anti-CCR5 mAbs 181 (Mab181) and ... present in lane a, the heavy and light chains of the anti-CD4 Ig (50 and 25 kDa, respectively, lane a) are also revealed by the anti-mouse IgG secondary antibody, while no CCR5 is detected in lane b ... blot analysis was carried out using an anti-myc Ig Transfected cells are marked with +, nontransfected cells that were used as a negative control, with - The approximate position of molecular mass...
Ngày tải lên: 08/03/2014, 09:20
Báo cáo khoa học: Characterization and regulation of a bacterial sugar phosphatase of the haloalkanoate dehalogenase ppt
... P A G I L I D ATCGAAAACACGGAGCAAATGCGTATTATGGCCAGTCATGATACGCCTGTGTCACCGGCTGGCATTCTGATTGAC A A A WT 2947.9 kb araA araB araD araL araM araN araP araQ abfA IQB832 araA araB araD araM araN araP araQ ... Oligonucleotides ARA28 ARA253 ARA358 ARA439 ARA440 ARA444 ARA451 ARA456 ARA457 ARA458 ARA459 ARA460 ARA477 ARA486 ARA487 ARA509 ARA510 ARA514 ARA515 CCTATTGAATTCAAAAGCCGG TAACCCCAATCTAGACAGTCC CTGCTGTAATAATGGGTAGAAGG ... CTGCTGTAATAATGGGTAGAAGG GGAATTCCATATGCGTATTATGGCCAG TATTTACTCGAGAATCCCCTCCTCAGC CGGGATCCACCGTGAAAAAGAAAGAATTGTC GAATTCATAAAGAAGCTTTGTCTGAAGC CGGCGCGTCATATGGCCAGTCATGATA TGATACGCATATGTCACCGGCTGGC CTCAGCCAATTTGGTTACATCCTTGTCCAAGTCAATCAGAATGCCAGCCGGTGCCAC...
Ngày tải lên: 14/03/2014, 23:20
Báo cáo khoa học: Identification and functional characterization of an aggregation domain in long myosin light chain kinase ppt
... analysis Experimental procedures Reagents and animals Restriction enzymes were purchased from Takara Company (Kyoto, Japan), and all antibodies, including secondary antibody and antibody to green ... myotilin, and palladin [30–35] As Ig-C2 domains may serve as molecular spacers and bind to a diversity of ligands, it is believed that they have important physiological and structural significance ... intracellular member of the immunoglobulin superfamily Proc Natl Acad Sci USA 87, 2157–2161 32 Noguchi J, Yanagisawa M, Imamura M, Kasuya Y, Sakurai T, Tanaka T & Masaki T (1992) Complete primary...
Ngày tải lên: 30/03/2014, 04:20
Báo cáo y học: "Functional analysis of an arthritogenic synovial fibroblast" docx
... proinflammatory and antiinflammatory factors, chemoattractants, and factors that promote angiogenesis, matrix degradation and tissue remodeling, bone formation, and osteoclastogenesis [17] animal facilities ... Translation initiation factor (Eif4g2) MA(AA408104) Translational initiation factor (eIF-2) α MA(AA254996) Alanyl-tRNA synthetase Protein degardation MA(U19854) ubiquitinating enzyme E2-20K MA(X97042) ... Yamamoto K, Shirai T, Hirohata K, Nishioka K: Apoptosis and functional Fas antigen in rheumatoid arthritis synoviocytes Arthritis Rheum 1995, 38:485-491 Hashiramoto A, Sano H, Maekawa T, Kawahito...
Ngày tải lên: 09/08/2014, 01:21
Báo cáo lâm nghiệp: "Contribution of different solutes to the cell osmotic pressure in tap and lateral roots of maritime pine seedlings: effects of a potassium deficiency and of an all-macronutrient deficienc" pptx
... of a bunch of primary leaves), of the tap root (TR) and of the three longest lateral roots (LR; as an assessment of the length of the lateral roots) of each plant were measured just before harvest ... than by KD as also happened in TRA (figure 4A) [Cl] and [PO were reduced as com] pared with control plants and [soluble sugars] and [Na] increased largely Cell π decreased and the fraction of ... detection and an autosuppression recycle mode (Dionex DX 300, Sunnyvale, USA) This was associated with an automatic were 2.4.3 Amino-acid analysis Extraction was carried out at °C 40 μL of internal...
Ngày tải lên: 09/08/2014, 04:20
Báo cáo y học: "Identification of a SmD3 epitope with a single symmetrical dimethylation of an arginine residue as a specific target of a subpopulation of anti-Sm antibodies" ppsx
... epitopes assay Assay performance characteristics of the anti-SmD3 peptide (SMP) assay (a) Intra-assay and interassay variability, (b) linearity, and (c) receiver operating characteristic analysis ... 40:413-418 29 James K, Carpenter AB, Cook L, Marchand R, Nakamura RM: Development of the antinuclear and anticytoplasmic antibody consensus panel by the Association of Medical Laboratory Immunologists ... Reference panels The CDC and the AMLI reference panels for ANA were evaluated using the new SMP ELISA Increased titres were found in ANA (10.3 U/ml) and ANA (910 U/ml) from the CDC panel and in samples...
Ngày tải lên: 09/08/2014, 06:22
Báo cáo y học: "Protocol for the Foot in Juvenile Idiopathic Arthritis trial (FiJIA): a randomised controlled trial of an integrated foot care programme for foot problems in JIA" pdf
... subtalar, talonavicular, calcaneocuboid, cuneonavicular, and tarsometatarsal joints will be scanned in both longitudinal and transverse planes, along with the calcaneal and retrocalcaneal bursa, ... scanned to include the dorsal and medial 1st MTP joint; dorsal and plantar 2nd-4th MTP joints and the dorsal, lateral and plantar aspect of the 5th MTP joint [37] Proximally, the tibio-talar, ... health related quality of life (HRQOL) [10,11], and high health care costs have been reported [12,13] Significant advances in the pharmacological management of JIA have taken place with the advocated...
Ngày tải lên: 10/08/2014, 21:23
báo cáo khoa học: " A quasi-experimental test of an intervention to increase the use of thiazide-based treatment regimens for people with hypertension" docx
... included approximately 150 trainee physicians in postgraduate years one to three during any academic year, staff assistants, and roughly 6,000 adult patients Target panel sizes ranged from 25 patients ... for the prevalence of hypertension, use of thiazides and other anti-hypertensives, and blood pressure goal attainment Assess and establish data quality Review and format GMS and PC data on study ... that a deputy secretary of the Department of Veterans Affairs has stated that he will return any financial saving reaped by increased use of thiazide-based regimens to the VA medical center that...
Ngày tải lên: 11/08/2014, 05:22
Báo cáo y học: "dentification of the protease cleavage sites in a reconstituted Gag polyprotein of an HERV-K(HML-2) element" doc
... apparent molecular masses of 15 kDa and approximately 18 kDa as well as an additional weaker band between these two The two major proteins of this subdomain, the CA protein of fraction 56 and ... the major peaks (fraction 34, 43, 45, 56 and 59) were analyzed by Western blot using the antisera against the presumed MA (left panel), p15 (central panel) and CA (right panel) domains but, as ... blot analysis of oricoHERVK113_ GagProPol mutants carrying amino acid changes at the P1 position of the MASP1 site (Y13 4A, lane 1), the CA-NC site (G532D, lane 2) and the p15- CA site (F282D, lane...
Ngày tải lên: 13/08/2014, 01:20
A systemic functional analysis of multisemiotic biology texts 5
... Ideational meanings made in the verbal text, while a statistical graph, such as Figure Q17-1, transforms a set of quantitative data into a visually perceptible object Although many aspects of ... 17-3 with a discussion of the ideational complementarity of language and visual images Stripped of the language, the visuals (circles and especially arrows) seem to tell a story and speak for themselves ... Question and relevant main text, and finally to the graph again Within the graph, after locating the orientations of the graph and identifying what the horizontal x-axis and the vertical y-axis refer...
Ngày tải lên: 17/09/2015, 17:19
A systemic functional analysis of multisemiotic biology texts 3
... using basically the same framework: a trio -functional analysis and an interpretation that relates to its social context of creation and other discourses of art: art history, art critics and teaching ... and New of a clause so that the New can be recognized at a glance and the New of one clause can be easily compared and contrasted with that of another clause However, as illustrated in Chapter ... types and styles of table The Publication Manual of the American Psychological Association (2001) recommends that a table consist of a title, headings (column head, stubhead, and optionally table...
Ngày tải lên: 17/09/2015, 17:19
A systemic functional analysis of multisemiotic biology texts 6
... instead, see language as meaning potential and the development of a foreign language as the progressive mastery of more and more delicate and diversified meanings To quote Hasan and Perrett (1994: ... a metalanguage – a language for talking about language, images, texts and meaning-making interactions” (New London Group 2000: 24) For many teaching purposes, a simplified version of Halliday ... multimodal nature of meaning-making in academic apprenticeship and professional life so as to better prepare the students for their current and future academic and professional life The analyses of...
Ngày tải lên: 17/09/2015, 17:19
A systemic functional analysis of multisemiotic biology texts 4
... Halliday and Matthiessen (1999: 182) call a simple thing) and a process, and a metaphorical happening by a nominalized process (what Halliday and Matthiessen (1999: 60) term as a macroparticipant) and ... centrifugation A prepositional phrase, on the other hand, offers a precise description, based on accurate measurement Manner: means As with Manner: quality, most instances of Manner: means are associated ... strange thing about space’) and one of mock fable (‘The lover and his lass’) As for the Circumstantial elements, 58.9% of all the circumstantial instances in his data are Location: place and...
Ngày tải lên: 17/09/2015, 17:19
A systemic functional analysis of multisemiotic biology texts 2
... relations can be RE-construed and RE-enacted in the form of a range of other lexicogrammatical alternatives; grammatical metaphor expands the language’s resources to make meaning It follows that ... interclausally (in a clause complex of paratactic and hypotactic nature), and clausally (both transitivity congruent and metaphorical), totaling more than 22 expressions of the 37 general logical relation ... alternative and oppositional The paradigmatic orientation allows us to explore what potential meanings are put at risk in a language or a variety of language and to account for why this is so by relating...
Ngày tải lên: 17/09/2015, 17:19
A systemic functional analysis of multisemiotic biology texts 1
... They are an inherent part of the meaning potential of a language An important aspect of the meaning of negative is that it is significantly less likely than positive; it takes up considerably ... analyses of the clause-level experiential, interpersonal and textual meanings and of the interclausal logical meanings exist as database files Biotext 1, Biotext and Biotext 3, available from the author ... (communicative schemata) Language as meaning potential Yes (system network) No Approach Area of comparison Relationship between text Yes (Realization) and context No Table 1.1 A comparison of two approaches...
Ngày tải lên: 17/09/2015, 17:19
Meshing a 3d point cloud of an elevation surface based on 2d delaunay triangulation
... Floriani and Puppo (1989) and Chew et al [16] (1989) All these algorithms take advantage of the special structure of polygons and are also handle the general case of a PSLG and its efficiency can ... all triangles in the triangulation if it is a Delaunay triangulation 2.1 Background Surface triangulation is fast, memory-efficient, and robust for mesh generating An optimal triangular surface ... homeomorphic to and within a bounded distance from the original manifold The output of triangulating mesh is a manifold subset of an alpha-shape that some of the particular their properties can also be...
Ngày tải lên: 03/11/2015, 22:50