7  create a new array as a subset of an existing array

Báo cáo khoa học: Nck-1 selectively modulates eIF2aSer51 phosphorylation by a subset of eIF2a-kinases docx

Báo cáo khoa học: Nck-1 selectively modulates eIF2aSer51 phosphorylation by a subset of eIF2a-kinases docx

... effectors to a subset of activated receptor tyrosine kinases at the plasma membrane (reviewed in [27]) In an analogous fashion, Nck may target a holophosphatase complex to specific subcellular compartments, ... and treated as in (A) Bar, standard error of the mean *1P < 0.01, *2P < 0.001 both functionally and structurally similar to mammalian GCN2 (reviewed in [2]) In yeast, phosphorylation of eIF 2a ... phosphorylation mediated by HRI Sodium arsenite was used to activate HRI in HeLa cells [23] Phosphorylation of eIF2aSer51 was observed as early as 30 post-treatment, but was transient and started...

Ngày tải lên: 07/03/2014, 05:20

11 378 0
Báo cáo khoa học: In vitro gamma-secretase cleavage of the Alzheimer’s amyloid precursor protein correlates to a subset of presenilin complexes and is inhibited by zinc potx

Báo cáo khoa học: In vitro gamma-secretase cleavage of the Alzheimer’s amyloid precursor protein correlates to a subset of presenilin complexes and is inhibited by zinc potx

... indistinguishable from that of e-3FLAG standard (Fig 3B, lane 1) but a slightly faster mobility than the c-3FLAG standard (Fig 3C, lane 1) Using C101-3FLAG, c-3FLAG and e-3FLAG standards as molecular mass ... molecular mass of the CTF migrating faster than C101-3FLAG as an a- CTF within 27 Da of the calculated molecular mass Finally the same line was used to predict the molecular mass of a third FLAG-reactive ... arrow marked ‘c std’ Lane 2, lysate sample alone Note that a separation between c-3FLAG standard and e-CTF-3FLAG was achieved in lane An uncharacterized anti-FLAG immunoreactive protein migrating...

Ngày tải lên: 16/03/2014, 23:20

14 423 0
Báo cáo khoa học: Vps4 regulates a subset of protein interactions at the multivesicular endosome doc

Báo cáo khoa học: Vps4 regulates a subset of protein interactions at the multivesicular endosome doc

... Vps4 SalI F Vps4 Dstr R YEE F YEE R IRA F IRA R CGCTGCAGTAAGAGCAGTAAACCCG GAGAATCAGTGTCGACTTCATCTATAAAAATAATAGAAGGTTTATT GCCCATATTCGTCGACGCGCTAACAGGTACCAGAGGAGAAGGAGAGAGCGAAGCAAGTAG GGGCGGATCCTCTGCTTTTCTTTATC ... GGGCGGATCCTCTGCTTTTCTTTATC CTGGACACAGCCACGCAGTATACAGCATACTATAACGG CCGTTATAGTATGCTGTATACTGCGTGGCTGTGTCCAG CCTAAGTCGAAGGATTTGAAGCACTTGGAAAGTGAAG CTTCACTTTCCAAGTGCTTCAAATCCTTCGACTTAGG Table Plasmids used in ... morphology in mammalian cells Mol Biol Cell 11, 747–763 16 Fujita H, Yamanaka M, Imamura K, Tanaka Y, Nara A, Yoshimori T, Yokota S & Himeno M (2003) A dominant negative form of the AAA ATPase SKD1...

Ngày tải lên: 23/03/2014, 09:20

14 371 0
Báo cáo toán học: "Subsums of a Zero-sum Free Subset of an Abelian Group" pptx

Báo cáo toán học: "Subsums of a Zero-sum Free Subset of an Abelian Group" pptx

... \ {a3 , a6 }, a2 1 ∈ A \ {a2 , a1 4 , a1 6 }, a2 2 ∈ A \ {a2 , a5 , a7 , a1 1 , a1 4 }, and a2 3 ∈ A \ {a2 , a5 , a7 , a1 1 , a1 4 , a1 6 } We distinguish four cases Case 1: a1 8 = a3 That is x1 + x2 + ... elements of order 2, by Lemma 2.4 we infer that a1 , a2 , , a1 7 are pairwise distinct Let A = {a1 , a2 , a3 , a4 , a5 , a6 , a7 , a8 , a9 , a1 0 , a1 1 , a1 2 , a1 3 , a1 4 , a1 5 , a1 6 , a1 7 } By Lemma ... contains no elements of order 2, we have a3 = a1 4 , a1 2 = a1 9 , a1 3 = a1 8 , a1 4 = a1 7 , a1 5 = a1 6 This together with Lemma 2.4 shows that a1 , a2 , a3 , a4 , a5 , a6 , a7 , a8 , a9 , a1 0 , a1 1...

Ngày tải lên: 07/08/2014, 21:20

36 186 0
Báo cáo y học: "Atypical clinical presentation of a subset of patients with anti-RNA polymerase III - nonscleroderma cases associated with dominant RNA polymerase I reactivity and nucleolar staining" potx

Báo cáo y học: "Atypical clinical presentation of a subset of patients with anti-RNA polymerase III - nonscleroderma cases associated with dominant RNA polymerase I reactivity and nucleolar staining" potx

... shoulders and abdomen, and flexion contractures of the fingers were noted in March 2005 She was hospitalized in 2008 for anemia caused by gastric antral vascular ectasia (GAVE) Another very similar case ... Satoh T, Ishikawa O, Ihn H, Endo H, Kawaguchi Y, Sasaki T, Goto D, Takahashi K, Takahashi H, Misaki Y, Mimori T, Muro Y, Yazawa N, Sato S, Takehara K, Kuwana M: Clinical usefulness of anti-RNA ... ACR: American College of Rheumatology; ANA: antinuclear antibodies; GAVE: gastric antral vascular ectasia; ILD: interstitial lung disease; IP: immunoprecipitation; IRB: Institutional Review Board;...

Ngày tải lên: 12/08/2014, 17:22

7 320 0
Báo cáo y học: " Aberrant splicing of the hRasGRP4 transcript and decreased levels of this signaling protein in the peripheral blood mononuclear cells in a subset of patients with rheumatoid arthritis" pdf

Báo cáo y học: " Aberrant splicing of the hRasGRP4 transcript and decreased levels of this signaling protein in the peripheral blood mononuclear cells in a subset of patients with rheumatoid arthritis" pdf

... hands domain CDC25 box * * variant (581AA) * variant (604AA) variant (484AA) * 7, 8, * 14 int 15 * 7, * variant 11 (642AA) * variant 12 (454AA) 11 int 12 variant 13 (669AA) 12 variant 14 (454AA) ... Variant Variant Variant FL Variant Variant FL FL Variant Variant Variant Variant Variant DAS28: The Disease Activity Score in 28 joints; FL: full-length; IFX: infliximab; MTX: methotrexate; PSL: ... Japan) Irrelevant rabbit IgG served as another negative control for our anti-hRasGRP4 antibodies An absorption staining procedure was performed using a cocktail mixture of our anti-hRasGRP4 antibodies...

Ngày tải lên: 12/08/2014, 18:20

37 422 0
spinoreticular tract neurons the spinoreticular tract as a component of an ascending descending loop

spinoreticular tract neurons the spinoreticular tract as a component of an ascending descending loop

... ventral edge of the medulla on a line that separates the alar and basal plate derivates during development (Allen AM et al., 1988, Huang X-F and Paxinos G, 1995) and thus serves as an anatomical ... gamma amino butyric acid GAD glutamate decarboxylase Gi,LPGi gigantocellular reticular and lateral paragigantocellular GLYT2 glycine transporter HRP horseradish peroxidase HRP-WGA HRP conjugated ... differentiates into a principal dorsomedial magnocellular part and a ventrolateral parvicellular part The parvicellular part appears as a thin strip that is fused laterally to the larger wedge shaped...

Ngày tải lên: 22/12/2014, 20:23

326 298 0
A study oF An alternative approach to teaching essay writing to TOEFL learners Minor Thesis

A study oF An alternative approach to teaching essay writing to TOEFL learners Minor Thesis

... Vietnam national University, Hanoi College of Foreign Languages Department of Postgraduate Studies A study oF An alternative approach to teaching essay writing to TOEFL learners (Nghiên ... phơng pháp dạy viết Luận cho học viên chứng ToefL) By: Nguyen Thi Chung Mien Supervisor: Do Ba Quy, MA Hanoi, 2005 ...

Ngày tải lên: 06/11/2012, 10:35

2 528 0
A study oF An alternative approach to teaching essay writing to TOEFL learners Minor Thesis

A study oF An alternative approach to teaching essay writing to TOEFL learners Minor Thesis

... explain the purpose, relevance and importance of the study, as well as to clarify any questions that the learners had The data were collected and analyzed to survey the learners’ activity and ... kinds and parts of an essay Semantic and syntactic variety remained their weak points The learners evaluated their knowledge of kinds of essay, coherence, unity and mechanics on an average level ... effect, the second cause goes with its effect and the next appear accordingly as in a “chain” Lastly, comparison and contrast is a very common and useful pattern of essay organization and it is frequently...

Ngày tải lên: 06/11/2012, 10:35

48 604 1
A study oF An alternative approach to teaching essay writing to TOEFL learners Minor Thesis

A study oF An alternative approach to teaching essay writing to TOEFL learners Minor Thesis

... school have to some extent, a great affect on them They interact and play with each other and can give them advice immediately Moreover, they are at the same or around age so they can more easily ... learn from other sources WRITING PAPER Name: Group A Paper: 02F6g Task: 02 AD Write: It’s said that parents are always the best teachers but we strongly disagree with the above statement Because ... PAPER Name: Group D Paper: 02F5g Task: 02 AD Write: I strongly agree with the statement that parents are the best teachers for three following reasons: they are old and experience; they always...

Ngày tải lên: 06/11/2012, 10:35

4 481 0
bridge of birds a novel of an ancient china that never was

bridge of birds a novel of an ancient china that never was

... breeze, and we languidly waved goldsplattered Szech'uen fans A servant brought up the rear, dragging a cart filled with garbage and a mangy goat The servant was a thug of low appearance with a bandage ... could match it I once asked him the name of a distant mountain, and this is the answer that I received "The sacred mountains are five in number: Hengshan, Changshan, Huashan, Taishan, and Sungshan, ... marched ahead of us and bashed the lower classes out of the way with a gold-tipped staff OneEyed Wong was dressed as the majordomo of a great house, and Fat Fu was attired as a noble nurse, and...

Ngày tải lên: 30/05/2014, 23:29

117 416 0
Modeling in MathWorks Simscape  by building a model of an automatic  gearbox

Modeling in MathWorks Simscape by building a model of an automatic gearbox

... equation for planetary gear train can be written as: (1.25) And when the planetary gear is moving along a solid axle the angular speed is the same ( and ) The equation above can now be written as: ... RBNP has a background at Scania with manual and automatic transmission, both in production and implementation/calibration in bus chassis 2.2 Modeling and simulation tools used All tools that are ... 2010) Table 3: Simscape predefined physical domains Physical Domain Across Variable Through Variable Electrical Hydraulic Magnetic Mechanical rotational Mechanical translational Pneumatic Thermal...

Ngày tải lên: 24/07/2014, 09:44

63 472 0
Báo cáo toán học: "A Survey of Binary Covering Arrays" doc

Báo cáo toán học: "A Survey of Binary Covering Arrays" doc

... that each facet of [0, 1]k+1 is itself a cube of dimension k, and any s-face transversal of [0, 1]k+1 must contain an s-face transversal of any two opposite facets, so CAN(k + 1, t + 1) ≥ CAN(k, ... paper by Grindal, Offutt, and Andler [43] Various Formulations The phrase “covering array was used in the paper by Sloane [75], to contrast these arrays with “orthogonal arrays,” and this terminology ... termed a v-valued covering array A covering array of strength t = is sometimes called a pairwise covering array Such arrays have proven useful in a variety of settings The use of such arrays in applications...

Ngày tải lên: 08/08/2014, 14:23

30 298 0
Báo cáo y học: "Nucleic acid chaperons: a theory of an RNA-assisted protein folding" ppt

Báo cáo y học: "Nucleic acid chaperons: a theory of an RNA-assisted protein folding" ppt

... CT CT AG CT X CT ACT AG XAG G CT X AG AGX CTX X X G CT T G G T G C A A CT A A C C AC AT A G T T C G A A T G A T A T T A C A G CG C T G A 3rd 2nd C G A A T G A T A T T A C A G CG C T G A G 2nd ... example acidic amino acids); these capture the amino acids at the attachment point and dissociate the ribonucleoprotein complex Transfer-RNAs are of course important participants in translation, ... principle was formulated in the 1960s using purely chemical experiments and a lot of intuition Today, many sequences and structures are available to establish a logical and understandable link...

Ngày tải lên: 13/08/2014, 23:20

11 237 0
Orientalism and integrative history a study of an early 20th century islamic periodical in singapore

Orientalism and integrative history a study of an early 20th century islamic periodical in singapore

... Indies: Malacca, Johor, Kuala Lumpur, Pulau Pinang, Serdang, Pahang, Perak, Muar, Tanjung Pura, Selangor, Sumatra, Palembang, Padang Panjang, Padang, Bali, Java(Pamelang) and Aceh This was based ... Second, Al-Imam advocated the idea of an Islamized Japan assuming leadership of an ‘invigorated’ East26 Several articles in Al-Imam revealed the periodical’s at times unbridled admiration of Japan and ... book –Al Nasa’ih al-kafiya li-man yatawalla Mu’awiya (Ample admonitions to whomever accords allegiance to Mu’awiya) that angered Hasan b.Shibab, who was also one of Al-Imam’s board of directors tendency...

Ngày tải lên: 27/11/2015, 12:33

137 412 0
Tài liệu The Book Of Personal Transformation - How To Use Ancient Wisdom To Create A New Life For Yourself docx

Tài liệu The Book Of Personal Transformation - How To Use Ancient Wisdom To Create A New Life For Yourself docx

... poem like a mantra as often as I can remember: Thank you for the abundance, Thank you for the wealth; Thank you for all the happiness, Protections and Good Health Repeat this mantra consistently ... inevitable, no one can stop the changes in life However, we can always choose to change for the better We can always change for personal and spiritual growth Here are a few areas we can change: ... lives AFFIRMATIONS Jeff Staniforth, the creator of Sculptor 3, an amazing software that can make affirmations work for anyone, has this to say about affirmations: “By definition, an affirmation...

Ngày tải lên: 15/12/2013, 06:15

59 772 3
Tài liệu CREATE A TOTAL ASSEMBLY DRAWING WITH BOM AS A NOTE docx

Tài liệu CREATE A TOTAL ASSEMBLY DRAWING WITH BOM AS A NOTE docx

... above to add the next sheet, and create the assembly drawing of pin link as shown below 24 CREATE A DRAWING FOR PIN LINK PLATE Create a detailed drawing of pin_link_plate as shown below 25 ... rpt.qty asm.mbr.name asm.mbr.User Defined, then type in material at Enter symbol text prompt Note that the parameter material is created in each part in Part mode 18 Create the BOM From the TABLE ... Name Material Make sure you hit Enter twice to finish entering text in particular cell The table should appear as shown below Create the Repeat Region Repeat Regions automatically add text and...

Ngày tải lên: 22/12/2013, 11:17

25 361 1
Tài liệu Create a Dialog Box to Connect to a New Database, Including Listing Available SQL Servers and Databases pdf

Tài liệu Create a Dialog Box to Connect to a New Database, Including Listing Available SQL Servers and Databases pdf

... string Called BuildCnnStr, the function can be seen in Listing 7.1 This function takes a server and database names passed to it and returns a connection string You will want to create a basic module ... Repopulating the List Boxes Based on the Current Category Selected Private Sub lstDatabases_SelectedIndexChanged(ByVal sender As System.Object, _ ByVal e As System.EventArgs) _ Handles lstDatabases.SelectedIndexChanged ... As Integer Dim oNames As SQLDMO.NameList Dim oSQLApp As New SQLDMO.Application() ' Load available SQL Servers into a NameList ' (those that are able to be seen by the network) oNames = oSQLApp.ListAvailableSQLServers...

Ngày tải lên: 21/01/2014, 12:20

10 480 0
Tài liệu Create a New SQL Server Database from Within Visual Studio .NET pptx

Tài liệu Create a New SQL Server Database from Within Visual Studio .NET pptx

... to create a new database, it does give you an idea of where you can see various databases in your system Now you will learn how to create a database in VS NET You can open the Create Database ... right-click on the SQL Server instance to which you want to add the database-in this case, SHADRACH2-and then choose New Database Although both methods open the Create Database dialog box, the second method ... need to create a new database Click OK to complete the dialog box and create the new database How It Works Now you when you click on the plus sign for the new database, you will see branches in...

Ngày tải lên: 21/01/2014, 12:20

3 462 0
w