765 first try at a state diagram for the guessing game

The first three minutes   a modern view of the origin of the universe   s  weinberg

The first three minutes a modern view of the origin of the universe s weinberg

... points A and B are the same, draw a circle through A around galaxy 1, and another circle through B around galaxy Isotropy around galaxy requires that conditions are the same at A and at the point ... anyone with an undergraduate concentration in any physical science or mathematics Fortunately, the most important calculations in cosmology are rather simple; it is only here and there that the ... this apparent paradox, including perhaps the steady -state theory It may be that the removal of the age paradox by the tenfold expansion of the extragalactic distance scale in the 1950S was the...

Ngày tải lên: 17/03/2014, 13:35

168 420 0
Báo cáo khoa học: "PEAS, the first instantiation of a comparative framework for evaluating parsers of French" potx

Báo cáo khoa học: "PEAS, the first instantiation of a comparative framework for evaluating parsers of French" potx

... for each relation the address of its parameters Of course, all of them are not to be filled in All the information thus annotated is then translated into an XML format Annotation of the example ... syntactical phenomena as broad as possible in order to allow any parser to participate, whatever the grammatical formalism it uses We have decided immediately upon a twosteps annotation: first the ... presegmented and original format The part of the corpus that has been annotated contains about 20,000 words The annotation tools, that we have developed, use an HTML editor For chunk marking, the annotator...

Ngày tải lên: 17/03/2014, 22:20

4 325 0
Báo cáo Y học: The presence of phosphate at a catalytic site suppresses the formation of the MgADP-inhibited form of F1-ATPase potx

Báo cáo Y học: The presence of phosphate at a catalytic site suppresses the formation of the MgADP-inhibited form of F1-ATPase potx

... and potassium phosphate as in (A) Relative ATPase activities were calculated by normalizing ATPase activities without preloaded MgADP at each potassium phosphate concentration to 100% The solid ... phosphate As shown in Fig 5A, B, MgATP binding was fast in the absence of phosphate, but slow in the presence of 10 mM phosphate at appropriate MgATP concentrations At 200 nM MgATP, the binding was ... range for thermophilic F1-ATPase activity ATP hydrolysis assay ATP hydrolysis was measured using an ATP-regenerating system as a decrease in A3 40 of NADH at 25 °C The assay mixture contained 50...

Ngày tải lên: 24/03/2014, 00:21

8 446 0
A Report Montana Legislature Financial Audit to the Montana State University For the Year Ended June 30, 2009_part2 pdf

A Report Montana Legislature Financial Audit to the Montana State University For the Year Ended June 30, 2009_part2 pdf

... which are in the Variable Rate Demand market, with rates reset daily A fixed-payer swap and a constant maturity swap are associated with the debt, as described in the notes to the financial statements ... were taken out through the State of Montana Intercap Loan program This is trial version www.adultpdf.com A- 8 Montana State University Management’s Discussion and Analysis As of and For Each of the ... designated are contained in Note 13 to the audited financial statements This is trial version www.adultpdf.com A- 10 Montana State University Management’s Discussion and Analysis As of and For Each...

Ngày tải lên: 18/06/2014, 20:20

11 303 0
A Report Montana Legislature Financial Audit to the Montana State University For the Year Ended June 30, 2009_part4 pdf

A Report Montana Legislature Financial Audit to the Montana State University For the Year Ended June 30, 2009_part4 pdf

... University pays that date’s 7-day SIFMA rate on the then-outstanding notional amount, and receives 86.8% of that date’s calculated 10-year SIFMA rate on the then- outstanding notional amount At June ... assets The University’s land grant assets are not reflected in these financial statements, but are included as a component of the State of Montana Basic Financial Statements that are prepared annually ... information demonstrating risk associated with the State of Montana Board of Investments STIP and TFBP is contained in the State of Montana Board of Investments financial statements, and may be accessed...

Ngày tải lên: 18/06/2014, 20:20

11 303 0
A Report Montana Legislature Financial Audit to the Montana State University For the Year Ended June 30, 2009_part5 ppt

A Report Montana Legislature Financial Audit to the Montana State University For the Year Ended June 30, 2009_part5 ppt

... ORP was made the mandatory retirement plan for new faculty and administrative staff The Pension Benefit Obligation is not available on an individual agency basis, but is available on a statewide ... (MCA §19-3-315 and MCA §19-3-316) Members’ rights become vested after years of service Additional information or a separate financial statement can be obtained from the State of Montana, Department ... of the last actuarial valuation The University does not contribute to the plan for retirees or their dependents As of the latest actuarial evaluation, the accrued liability for retiree health...

Ngày tải lên: 18/06/2014, 20:20

11 298 0
A Report Montana Legislature Financial Audit to the Montana State University For the Year Ended June 30, 2009_part6 doc

A Report Montana Legislature Financial Audit to the Montana State University For the Year Ended June 30, 2009_part6 doc

... revised data Additionally, the MSU Foundation statement data as presented below reflects a change in the methodology of accounting for a wholly owned private foundation Fair value accounting for the ... year financial statements, primarily due to the reclassifications of balances among net asset classifications Information for prior periods as presented below has been restated to reflect the revised ... nonprofit organizations affiliated with the University include the MSU Foundation, the MSU-Billings Foundation (including the Sting Athletic Association and the Alumni Association), the MSU-Northern...

Ngày tải lên: 18/06/2014, 20:20

11 264 0
A Report Montana Legislature Financial Audit to the Montana State University For the Year Ended June 30, 2009_part8 pptx

A Report Montana Legislature Financial Audit to the Montana State University For the Year Ended June 30, 2009_part8 pptx

... Commission on the Accreditation of Allied Health Educational Programs, American Association of Medical Assistants, Commission on Accreditation in Physical Therapy Education, Montana State Board of Nursing, ... Education approved the restructuring of the Montana University System Montana State University-Bozeman, Montana State University-Billings, Montana State University-Northern and Montana State ... Great Falls Vocational – Technical Center was established by the Montana State Legislature in 1969 to offer employment training in vocational and technical fields In January 1994 the Montana Board...

Ngày tải lên: 18/06/2014, 20:20

6 215 0
Báo cáo hóa học: " A Versatile Route for the Synthesis of Nickel Oxide Nanostructures Without Organics at Low Temperature" doc

Báo cáo hóa học: " A Versatile Route for the Synthesis of Nickel Oxide Nanostructures Without Organics at Low Temperature" doc

... plays an essential role in the precursor material transformation because the vapor pressure is much higher and the state of water at elevated temperatures is different from that at room temperature ... by the solvents and organics in the structural evaluation of NiO nanostructures The EDX measurement indicates that nanoparticles are composed of Ni and O, and the analysis in the NiO nanoparticles/nanoflowers ... FESEM images of nanoparticles and nanoflowers obtained by the reaction of nickel metal with water at 100 °C for 12–36 h (a) Images of samples at room temperature for 12 h, (b) at 100 °C for 12...

Ngày tải lên: 22/06/2014, 01:20

5 526 0
Báo cáo toán học: "A Colorful Involution for the Generating Function for Signed Stirling Numbers of the First Kind" pps

Báo cáo toán học: "A Colorful Involution for the Generating Function for Signed Stirling Numbers of the First Kind" pps

... suffices Acknowledgments The author thanks Herbert Wilf and Janet Beissinger, who was the first to explore [1] combinatorial proofs using colored permutations, for their assistance References [1] Janet ... generating function identities Unpublished notes, 1981 [2] Richard P Stanley Enumerative combinatorics Vol 1, volume 49 of Cambridge Studies in Advanced Mathematics Cambridge University Press, Cambridge, ... ˜(Kπ (p)) = f (Kπ (p)) for all p n Let φ((π, f )) = (˜ , f) f ˜ π ˜ Note that R(π,f ) = Rφ((π,f )) for all (π, f ) ∈ Sn ,A , and that therefore φ is involutive Note further that, if (π, f ) = φ((π,...

Ngày tải lên: 08/08/2014, 01:20

2 262 0
báo cáo khoa học: " Testing a TheoRY-inspired MEssage (''''TRY-ME''''): a sub-trial within the Ontario Printed Educational Message (OPEM) trial" pps

báo cáo khoa học: " Testing a TheoRY-inspired MEssage (''''TRY-ME''''): a sub-trial within the Ontario Printed Educational Message (OPEM) trial" pps

... educational materials (for example, mailing summaries of research findings to health care professionals) is a knowledge translation strategy commonly used in healthcare There have been few evaluations ... Diuretic: The Antihypertensive and Lipid-Lowering Treatment to Prevent Heart Attack Trial (ALLHAT) JAMA: The Journal of the American Medical Association 2002, 288:2981-2997 Grimshaw J, Zwarenstein ... on back of card • Cite the ALLHAT trial as the evidence base for the recommended behaviour Study participants and setting Participants are the primary care physicians in Ontario who receive the...

Ngày tải lên: 11/08/2014, 05:22

8 132 0
báo cáo khoa học: " Testing a TheoRY-inspired MEssage (''''TRY-ME''''): a sub-trial within the Ontario Printed Educational Message (OPEM) trial" pdf

báo cáo khoa học: " Testing a TheoRY-inspired MEssage (''''TRY-ME''''): a sub-trial within the Ontario Printed Educational Message (OPEM) trial" pdf

... educational materials (for example, mailing summaries of research findings to health care professionals) is a knowledge translation strategy commonly used in healthcare There have been few evaluations ... Diuretic: The Antihypertensive and Lipid-Lowering Treatment to Prevent Heart Attack Trial (ALLHAT) JAMA: The Journal of the American Medical Association 2002, 288:2981-2997 Grimshaw J, Zwarenstein ... on back of card • Cite the ALLHAT trial as the evidence base for the recommended behaviour Study participants and setting Participants are the primary care physicians in Ontario who receive the...

Ngày tải lên: 11/08/2014, 16:20

8 166 0
Báo cáo khoa học: " Characterization of a VHS virus genotype III isolated from rainbow trout (Oncorhychus mykiss) at a marine site on the west coast of Norway" doc

Báo cáo khoa học: " Characterization of a VHS virus genotype III isolated from rainbow trout (Oncorhychus mykiss) at a marine site on the west coast of Norway" doc

... chlamydia Sch-probe TCC TTC GGG ACC TTA C Sch-R CCC ATG AGC CGC TCT CTC T Elongation factor EL 1A- elaf CCC CTC CAG GAC GTT TAC AAA alpha EL 1A- elam1 ATC GGT GGT ATT GGA AC S salar EL 1A- elar CAC ACG ... CAC AGT ACC GTC AA TCA CCC CCA GGC TGC TT Piscichlamydia [49] TGT AAA CTG CTT TTG CAC AGG AA psychrophilum 59 nt GAA TTC CAT TTC CCC CTC TTG New species of Sch-F GGG TAG CCC GAT ATC TTCA AAG T ... test was as described above The dilution series was analyzed in triplicates using one-step real-time RT PCR The mean Ct value for each triplicate was calculated and a standard curve was made by...

Ngày tải lên: 12/08/2014, 04:21

15 253 0
báo cáo khoa học: " The PTI1-like kinase ZmPti1a from maize (Zea mays L.) co-localizes with callose at the plasma membrane of pollen and facilitates a competitive advantage to the male gametophyte" doc

báo cáo khoa học: " The PTI1-like kinase ZmPti1a from maize (Zea mays L.) co-localizes with callose at the plasma membrane of pollen and facilitates a competitive advantage to the male gametophyte" doc

... (5'-atgcgcgggcgactaaccctggagaacatg-3') and SP3 (5'-ccgagcctggaggcattctgttcaga-3') for ZmPti1b; SP7(5'-cgcaaccaccggcagccactactgacgcta-3') and SP8 (5'-taataaggtggtcacgaccgctg-3') for ZmPti1c; SP12 (5'-ctgcaccaaccaccgaagagccagctcca-3') ... Myr:GFP was cloned by in vitro annealing of oligonucleotides Myr -A (5'-P-gatccatgggatgcttttcatgctgctgtgtggcagatgacgacaacgttggcaggaggaagaagcat-3') and Myr-B (5'-Pgatcatgcttcttcctcctgccaacgttgtcgtcatctgccacacagcagcatgaaaagcatcccatg-3') ... gi|38488409 Nicotiana tabacum gi|38488407 Nicotiana tabacum gi|50909605 Oryza sativa 0.1 ZmPti1c At2 g43230 Arabidopsis thaliana At3 g59350 Arabidopsis thaliana At1 g06700 At2 g30740 Arabidopsis Arabidopsis...

Ngày tải lên: 12/08/2014, 05:20

22 324 0
A STUDY ON GRADE 10 TH STUDENTS’ PERCEPTIONS TOWARDS LEARNING TO READ ENGLISH AT A HIGH SCHOOL IN THE NORTH OF VIETNAM

A STUDY ON GRADE 10 TH STUDENTS’ PERCEPTIONS TOWARDS LEARNING TO READ ENGLISH AT A HIGH SCHOOL IN THE NORTH OF VIETNAM

... 2001) The studies above, therefore, indicate that, generally, multiple factors may play a crucial role in the creation of reading habits Research has also found that an important factor in the ... extents, pleasure reading and extensive reading are not completely the same Maley (2008) states the purposes of ER that are for pleasure, information and general understanding It means that in addition ... Postgraduate Studies at Vietnam National University, Hanoi – University of Languages and International Studies, whose lectures and ideas have inspired my thesis My appreciation also goes to the teachers...

Ngày tải lên: 10/07/2015, 14:50

63 589 1
A WEB APPLICANTION FOR THE TOURISM INDUSTRY IN HANOI   by   Dinh Huu Son

A WEB APPLICANTION FOR THE TOURISM INDUSTRY IN HANOI by Dinh Huu Son

... involves the transmission of payment transaction data, and associated remittance advice data, from a payee to their bank, for onforwarding (via banks and/or value-added network operators) to the payee's ... interface for service suppliers to update their own database So, there is no immediate link from the application’s database and the database of the suppliers 1.7 Organization of the research • ... of Hanoi and the very particular features that Hanoi has In addition to that, on the day before the trip, they may find it useful to have some news What is going on as well as weather information?...

Ngày tải lên: 07/04/2013, 23:51

58 474 0
Tài liệu Machinery''''s Handbook 27th Edition A REFERENCE BOOK FOR THE MECHANICAL ENGINEER, docx

Tài liệu Machinery''''s Handbook 27th Edition A REFERENCE BOOK FOR THE MECHANICAL ENGINEER, docx

... a = aa = a a = ⎛ a ⎝ b⎠ b3 a × a × a = aaa = a a × b = ab a b = ( ab ) = ⎛ 1⎞ = a – -⎝ a a3 a2 a3 = a2 + = a5 ( a2 )3 = a2 × = ( a3 )2 = a6 a4 ÷ a3 = a4 – = a a + b = ( a + b ) ( a – ab ... on a plane, and perpendiculars are drawn from P to the coordinate axes, one perpendicular meets the X–axis at the x– coordinate of P and the other meets the Y–axis at the y–coordinate of P The ... INTERACTIVE EQUATIONS 2689 INDEX OF MATERIALS 2694 ADDITIONAL INFORMATION FROM THE CD 2741 • MATHEMATICS • CEMENT, CONCRETE, LUTES, ADHESIVES, AND SEALANTS • SURFACE TREATMENTS FOR METALS • MANUFACTURING...

Ngày tải lên: 15/12/2013, 03:15

3,3K 638 2
w