5influence of constitutive modelling in a 3d head model

Therapy response testing of breast cancer in a 3D high-throughput perfused microfluidic platform

Therapy response testing of breast cancer in a 3D high-throughput perfused microfluidic platform

... screen and detect inter-in-dividual heterogeneity of paracrine interactions between T47D breast carcinoma cells and breast carcinoma-associated fibroblasts of various grades or normal mammary fibroblasts ... for Individualized Medicine Pharmacogenomics Translational Program The funding bodies had no role in the design of the study and collection, analysis, and interpretation of data and in writing ... F, Coinu A, Borgonovo K, Cabiddu M, Ghilardi M, Lonati V, et al The value of platinum agents as neoadjuvant chemotherapy in triple-negative breast cancers: a systematic review and meta-analysis

Ngày tải lên: 06/08/2020, 04:34

11 29 0
Curcumin potentiates antitumor activity of 5-fluorouracil in a 3D alginate tumor microenvironment of colorectal cancer

Curcumin potentiates antitumor activity of 5-fluorouracil in a 3D alginate tumor microenvironment of colorectal cancer

... grown in an incubator at 37°C with 5% CO2in air Phase contrast of alginate bead cultures In order to investigate the behavior and vitality of CRC cells in alginate bead culture, whole alginate beads ... factors in comparison to the parental HCT116, suggesting an increase in malignancy behavior In alginate, curcumin potentiated 5-FU-induced decreased capacity for proliferation, invasion and increased ... encapsulated in alginate were able to proliferate in 3D-colonospheres in avivo-like phenotype and invaded from alginate During cultivation of cells in alginate, we could isolate 3 stages of cells,

Ngày tải lên: 29/09/2020, 15:58

15 20 0
longitudinal label free quantitative tracking of cell death and viability in a 3d tumor model with oct

longitudinal label free quantitative tracking of cell death and viability in a 3d tumor model with oct

... culture models are of particular significance in studies of therapeutic response in ovarian cancer as their size and complexity are similar to that of ovarian metastatic lesions Metastatic ovarian ... found capable of reversing therapeutic resistance in ovarian cancer27 As therapeutic resistance is the primary reason for ovarian cancer deaths, any modality capable of reversing resistance is of ... indicating that the treatment led to well-defined levels of programmed cell death When measuring surface-area-to-volume, on the other hand, there was greater spread in the data indicating variability

Ngày tải lên: 04/12/2022, 15:04

11 2 0
DSpace at VNU: Classification of Asymptotic Behavior in a Stochastic SIR Model

DSpace at VNU: Classification of Asymptotic Behavior in a Stochastic SIR Model

... Trang 1Classification of Asymptotic Behavior in a Stochastic SIR Model∗N T Dieu†, D H Nguyen‡, N H Du§, and G Yin‡ Abstract Focusing on asymptotic behavior of a stochastic SIR epidemic model ... characterization of the support of the invariant measure Rates of convergence are also ascertained It is shown that the rate is not too far from exponential in that the convergence speed is of the ... The infected class: those individuals who are capable of transmitting the disease to others • (R) The removed class: infected individuals who are deceased, or have recovered andare either permanently

Ngày tải lên: 16/12/2017, 05:57

23 133 0
Economic doctoral thesis summary economic power of rural women in a new cooperative model in vietnam

Economic doctoral thesis summary economic power of rural women in a new cooperative model in vietnam

... Neccessity of the research topic In Vietnam, rural women are a major contributor to the industrialization and modernization of agriculture and rural areas With accounting for more than 47% of the rural ... be analyzed, data are calculated and shown in the corresponding table or drawing The number of votes given out is 300 and the number of votes collected is 293 - Methods of data and data analysis: ... Change in capacity to collect, analyze, manage and apply information in production development Change in capacity to participate, make decisions and enjoy results in the new-type cooperative model

Ngày tải lên: 13/01/2021, 20:03

27 13 0
Dysregulated cholinergic network as a novel biomarker of poor prognostic in patients with head and neck squamous cell carcinoma

Dysregulated cholinergic network as a novel biomarker of poor prognostic in patients with head and neck squamous cell carcinoma

... Background Head and neck carcinomas arise in the mucosal layer of the upper aerodigestive tract (oral cavity, oropharynx, hypopharynx, and larynx) Nearly 90 % of head and neck carcinomas are assigned ... Hospital Virgen de la Arrixaca, IMIB-Arrixaca, Ctra Madrid-Cartagena s/n, El Palmar, Murcia 30120, Spain Full list of author information is available at the end of the article © 2015 Castillo-González ... cancerous pieces The data showed that ANCT sam-ples contained principal T mRNA and less AChE-Table 2 Correlation of variables with outcome in head and neck carcinomas Variable Overall survival

Ngày tải lên: 30/09/2020, 10:56

13 15 0
genetic toxicity assessment of engineered nanoparticles using a 3d in vitro skin model epiderm

genetic toxicity assessment of engineered nanoparticles using a 3d in vitro skin model epiderm

... statistical analysis was notattempted and they are instead presented as preliminaryfindings to promote discussions regarding the importance of cellular uptake assessment in the avoidance of falsepositive ... harvested on each day of the assay, stained withhaemotoxylin and eosin and optically imaged in cross-section (Fig 3a–d) From arrival to harvest, the stratumcorneum layer was seen to increase in thickness ... spectrometry Com-paring a blank area of the TEM grid to an area containingnanoparticles revealed a large shift in the ratio of the oxy-gen and silicon peaks, confirming the silicon dioxideparticle composition

Ngày tải lên: 04/12/2022, 10:35

21 4 0
numerical modelling of ultrasonic waves in a bubbly newtonian liquid using a high order acoustic cavitation model

numerical modelling of ultrasonic waves in a bubbly newtonian liquid using a high order acoustic cavitation model

... experiments in water [14] for validation A plethora of empirical observations of acoustic cavitation in water is available in the literature For example, observations of streamers and acoustic Lichtenberg ... the saturation curve that separates single phase and two-phase domains [40] These numerical instabilities can be avoided by treating the speed of sound as a constant, thereby restricting the accuracy ... acoustic cavitation in liquid aluminium, expressed in an experimentally validated numerical model, is presented in this paper To improve the understanding of the cavitation process, a non-linear acoustic

Ngày tải lên: 04/12/2022, 15:46

31 5 0
Đề tài " The space of embedded minimal surfaces of fixed genus in a 3-manifold I; Estimates off the axis for disks " doc

Đề tài " The space of embedded minimal surfaces of fixed genus in a 3-manifold I; Estimates off the axis for disks " doc

... Annals of Mathematics The space of embedded minimal surfaces of fixed genus in a 3-manifold I; Estimates off the axis for disks By Tobias H Colding and William P Minicozzi II Annals of Mathematics, ... together along an axis GRAPHICAL OFF THE AXIS 31 BR A B C Figure 4: Proving Theorem 0.2 A Finding a small N -valued graph in Σ B Extending it in Σ to a large N -valued graph C Extending the number of ... surfaces of fixed genus in a 3-manifold III; Planar domains, Ann of Math., to appear; math.AP/0210141 [CM6] ——— , The space of embedded minimal surfaces of fixed genus in a 3-manifold IV; Locally simply

Ngày tải lên: 14/03/2014, 22:20

43 410 0
Pulmonary Tuberculosis: Knowledge, Attitudes and Practices of Selected Physicians in a Tertiary-Care Hospital docx

Pulmonary Tuberculosis: Knowledge, Attitudes and Practices of Selected Physicians in a Tertiary-Care Hospital docx

... tuberculosis cases have been increasing in number and have reached as high as 32% from reports from tertiary referral hospitals.3 Trang 2Physicians play a key role in the diagnosis and management of patients ... (n=36) of physicians fail to notify the health authority regarding pulmonary TB cases because of the lack of awareness among 53% (n=20) and because of paperwork involved in 26% (n=10) of respondents ... practices of specialist physicians in a tertiary–care hospital as to: a their idea of the magnitude of TB problem in the Philippines b their opinion of the National TB Program as well as the Directly-observed

Ngày tải lên: 15/03/2014, 03:20

10 517 1
Báo cáo khóa học: Vertical-scanning mutagenesis of amino acids in a model N-myristoylation motif reveals the major amino-terminal sequence requirements for protein N-myristoylation ppt

Báo cáo khóa học: Vertical-scanning mutagenesis of amino acids in a model N-myristoylation motif reveals the major amino-terminal sequence requirements for protein N-myristoylation ppt

... GCCGGGATCCATGGGCAAAACGCTGAGCAAAGAGGACAAGCTCGAG GCCGGGATCCATGGGCAAGCAGAATAGCGCACTGCGGCCAGACAAG GCCGGGATCCATGGGCAAGGCAGCATCTGCAGCAGCAGCAGACAAGCCTGTAGCC GCCGGGATCCATGGGCAAGGCAGCATCTAAGGCAGCAGCAGACAAGCCTGTAGCC AATTAACCCTCACTAAAGGG ... ATATGGATCCATGGCTGCGGCAGCAGCGGCAGCAGCAGCAGACAAGCCTGTAGCC ATATGGATCCATGGGCGCGGCAGCAGCGGCAGCAGCAGCAGACAAGCCTGTAGCC GCCGGGATCCATGGGCGCAGCAGCATCTGCAGCAGCAGCAGACAAGCCTGTAGCC GCCGGGATCCATGGGCGCAGCAGCANNKGCAGCAGCAGCAGAC ATATGGATCCATGGGCNNKGCAGCAGCGGCAGCAGCAGCAGAC ... ATATGGATCCATGGGCNNKGCAGCAGCGGCAGCAGCAGCAGAC GCCGCTCGAGCCTGTAGCCCATGTT AATTCTCGAGTGCTGCTGCTGCCGATGCTGC AATTCTCGAGTGCTGCTGCTGCCGTTGCTGC AATTCTCGAGTGCTGCTGCTGCGAATGCTGC GCCGGGATCCATGGGCAAAACGCTGAGCAAAGAGGACAAGCTCGAG

Ngày tải lên: 16/03/2014, 16:20

12 512 0
Báo cáo khoa học: Schemes of flux control in a model of Saccharomyces cerevisiae glycolysis docx

Báo cáo khoa học: Schemes of flux control in a model of Saccharomyces cerevisiae glycolysis docx

... V max parameters was used as the base model for parameter scanning using routines contained in GEPASI . METHODS Model A model of branched glycolysis, as described in [7] was obtained in SCAMP format ... glycolytic pathway. Much effort has already been invested in mathematical modelling of the glycolytic pathway in yeast [3–8] and in other organisms, such as Trypanosoma brucei, the parasite that causes ... multivariate and machine learning approaches are appropriate for such problems, and so we used the evolutionary programming algorithms incorporated in the metabolic modelling package GEPASI [14–16]

Ngày tải lên: 17/03/2014, 11:20

11 534 0
An Analysis of Power Consumption in a Smartphone doc

An Analysis of Power Consumption in a Smartphone doc

... making a GSM phone call The benchmark is trace-based, and includes loading the dialer application, dialing a number, and making a 57-second call The dialled device was configured to automatically ... simply launched them from the command line For interactive applications, such as web browsing, we took a trace-based approach A trace consisted of a sequence of input events, in-cluding a time-stamp, ... Trang 1An Analysis of Power Consumption in a SmartphoneAaron Carroll NICTA and University of New South Wales Aaron.Carroll@nicta.com.au Gernot Heiser NICTA, University of New South Wales and

Ngày tải lên: 23/03/2014, 13:20

14 720 0
Working PaPer SerieS no 1273 / DeCeMBer 2010: intereSt rate effeCtS of DeMograPhiC ChangeS in a neW-keyneSian life-CyCle fraMeWork pptx

Working PaPer SerieS no 1273 / DeCeMBer 2010: intereSt rate effeCtS of DeMograPhiC ChangeS in a neW-keyneSian life-CyCle fraMeWork pptx

... policy scenarios 4 Calibration and demographic trends 4.1 Calibration We calibrate the system of steady-state equations to match key features of annual euroarea data, taking, in particular, recent ... of Blanchard (1985), assuming that agents face a constant probability of death. Trang 112 The ModelThe model includes a number of features which are essential to analyze macroeconomiceects of ... Cobb-Douglas assumption for the composite ow utility of agents in Gertler (1999), real balances can be included as an additional variable without creating an extra analytical burden As we derive

Ngày tải lên: 29/03/2014, 13:20

49 458 0
Báo cáo khoa học: Tumor suppressor p16INK4a: Downregulation of galectin-3, an endogenous competitor of the pro-anoikis effector galectin-1, in a pancreatic carcinoma model pptx

Báo cáo khoa học: Tumor suppressor p16INK4a: Downregulation of galectin-3, an endogenous competitor of the pro-anoikis effector galectin-1, in a pancreatic carcinoma model pptx

... p16 INK4a protein had an effect. A clear decrease in the intensity of signals for Gal-3 was invariably observed, although proliferating cell nuclear antigen (PCNA) staining as a control for loading ... sialylation, have a bearing on protein functions in general and on integrins in partic- ular [5–8], glycan remodeling affords an attractive level of regulation of integrin functionality. The assumption of ... chromatographic glycan profiling and lectin binding [9]. Influencing N- and O-glycan galactosylation and sialylation, salient biochemical sig- nals in protein–carbohydrate ⁄ protein interplay [10–12], have

Ngày tải lên: 29/03/2014, 21:20

12 377 0
Báo cáo khoa học: The consensus motif for N-myristoylation of plant proteins in a wheat germ cell-free translation system ppt

Báo cáo khoa học: The consensus motif for N-myristoylation of plant proteins in a wheat germ cell-free translation system ppt

... AGG1 fused with a DNA fragment encoding the myristoylation motif Met-Gly-Ala-Ala-Ala-Ala-Ala-Ala-Ala-Ala or Met-Gly-Met-Gly-Ala-Ala-Ala-Ala-Ala-Ala-Ala-Ala-Ala-Ser-Met-Gly-Ala-Ala-Ala-Ala-Ala-Ala-Ala-Ala-Met-Gly-Ala-Ala-Ala-Ala-Ala-Ala-Ala-Ala ... Met-Gly-Xaa-Ala-Ala-Ala-Ala-Ala-Ala-Ala (Myr–AGG1-3X6A) or Met-Gly-Xaa-Ala-Ala-Ser-Ala-Ala-Ala-Ala (Myr–AGG1-3X6S) (B, C) Each of the 20 mRNAs corresponding to Myr–AGG1-3X6A (B) or Myr–AGG1-3X6S ... myristoylation motifs Met-Gly-Xaa-Ala-Ala-Ala-Ala-Ala-Ala-Ala (Myr–AGG1-3X6A) or Met-Gly-Xaa-Ala-Ala-Ser-Ala-Ala-Ala-Ala (Myr–AGG1-3X6S), with position 3 of each motif separately occupied by each of

Ngày tải lên: 29/03/2014, 21:20

12 476 0
Báo cáo hóa học: "Analysis of airway secretions in a model of sulfur dioxide induced chronic obstructive pulmonary disease (COPD)" potx

Báo cáo hóa học: "Analysis of airway secretions in a model of sulfur dioxide induced chronic obstructive pulmonary disease (COPD)" potx

... Hori A, Ishiura Y, Nobata K, Ogawa H, Yasui M, Kasahara K, Nakao S: Comparison of cough reflex sen-sitivity after an inhaled antigen challenge between actively and passively sensitized guinea pigs ... and structurally altered epitheepithe-lium after 20 days of exposure Epithelial cells displayed an increased height and a loss of ciliae Alcian blue staining (C, D) demonstrates an increase of ... assessed in a setting of phlegm production and bronchitis As it has been shown that the eradication of inflammatory cells does not automatically lead to an improvement of clinical symptoms in airway

Ngày tải lên: 20/06/2014, 00:20

10 569 0
báo cáo hóa học:" Quality of life and the impact of drug toxicities in a South African community-based antiretroviral programme" docx

báo cáo hóa học:" Quality of life and the impact of drug toxicities in a South African community-based antiretroviral programme" docx

... are few data from sub-Saharan Africa, where the vast majority of HIV-infected individuals live. This study examined health-related quality of life among HIV-positive individuals initiating HAART ... negative HRQoL and various socio-demo- graphic, baseline and on-treatment explanatory variables as appropriate. Multivariate analysis started with a full model (Model 1) and explanatory variables were ... Toga Laboratory performed viral load and CD4 cell count testing. Viral load testing made use of the branch DNA hybridisation technique (Versant™ HIV-1 RNA 3.0 branched chain DNA assay, Bayer HealthCare,

Ngày tải lên: 20/06/2014, 08:20

13 446 0
Báo cáo sinh học: " Prevention of genital herpes in a guinea pig model using a glycoprotein D-specific single chain antibody as a microbicide" pptx

Báo cáo sinh học: " Prevention of genital herpes in a guinea pig model using a glycoprotein D-specific single chain antibody as a microbicide" pptx

... Kappa Kappa Kappa Kappa Kappa Kappa Kappa Kappa Kappa 10 Kappa 11 C region kappa primer Signal sequence/framework primers Gamma Gamma Gamma Gamma Gamma Gamma Gamma Gamma Gamma Gamma 10 Gamma ... CCAAGCTGTGTCCTRTCC TGTTGACAGYCVTT CCKGGT TAYTTTAAAARGTGTCMAGTGT CTYTTAAAAGGKGTCCAGWG CYTTTAMATGGTATCCAGTGT ATGGCAGCWGCYCAAAG CTTTTAAAAGWTGTCCAGKGT CTTCCTGATGGCAGTGGTT TAACCCTTGACCAGGCATCC Key to degenerate nucleotides: ... TGGTGGGAAGATGGA GAGGTGAAGCTGCAGGAGTCAGGACCTAGCCTGGTG AGGTVMAACTGCAGVAGTCWGG AGGTVVAGCTGCAGVAGTCWGG ACTGCAGGTRTCCACTCC RCTACAGGTGTCCACTCC GCYACAGMTGTCCACTCC ACTGCAGGTGTCCTCTCT RCTRCAGGYGTCCACTCT CCAAGCTGTGTCCTRTCC...

Ngày tải lên: 18/06/2014, 22:20

10 541 0
w