5 optical characterization of black surfaces

Báo cáo hóa học: " Preparation and characterization of superhydrophobic surfaces based on hexamethyldisilazane-modified nanoporous alumina" pptx

Báo cáo hóa học: " Preparation and characterization of superhydrophobic surfaces based on hexamethyldisilazane-modified nanoporous alumina" pptx

... temperature range 150 °C to 450 °C They proposed that the initial reaction of HMDS Page of with the alumina surface occurs by the dissociative chemisorption of HMDS via reaction of coordinatively ... http://www.nanoscalereslett.com/content/6/1/487 Page of Figure Analysis of the solid surface fractional area of nanoporous alumina surfaces (a) High-magnification SEM image of the studied alumina surface (b) Identification of the solid ... Membranes of Chemisorbed and Physisorbed Molecules on Porous Alumina for Environmentally Important Seperation J Membr Sci 2006, 2 75: 255 Wang H, Dai D, Wu X: Fabrication of Superhydrophobic Surfaces...

Ngày tải lên: 21/06/2014, 01:20

8 463 0
báo cáo khoa học: "Optical characterization of colloidal CdSe quantum dots in endothelial progenitor cells" pptx

báo cáo khoa học: "Optical characterization of colloidal CdSe quantum dots in endothelial progenitor cells" pptx

... Leica TCS SP5 Confocal Microscopy System was used to characterize the optical properties of these samples Images were captured with a scanning speed of 400 Hz and image resolution of 51 2 × 51 2 pixels, ... Am Chem Soc 2003, 1 25: 1 256 7- 75 Yu WW, Qu L, Guo W, Peng X: Experimental Determination of the Extinction Coefficient of CdTe, CdSe, and CdS Nanocrystals Chem Mater 2003, 15: 2 854 -2860 Data in Science ... laser source at 458 nm was used Excitation power control was 20% Page of remained loosely attached to the bottom of the dish after washing steps The optical spectrum of one of such QD cluster...

Ngày tải lên: 11/08/2014, 00:22

8 216 0
Electronic, magnetic and optical properties of oxide surfaces, heterostructures and interfaces role of defects

Electronic, magnetic and optical properties of oxide surfaces, heterostructures and interfaces role of defects

... 152 Figure 5. 5 Temperature dependent carrier density of 0.05wt% NSTO 154 Figure 5. 6 Temperature dependence of mobility of 0.05wt% NSTO Solid lines are power law fittings 154 Figure ... A 5 5 μm2 AFM image of a 25 uc LAO grown on STO 192 Figure 6.11 A 5 5 μm2 AFM image of a 150 nm LAO film deposited on 0.5wt% NSTO 193 Figure 6.12 An optical microscopic image of ... density of 0.5wt% NSTO 156 Figure 5. 10 Temperature dependence of mobility of 0.5wt% NSTO Solid lines are power law fittings 156 Figure 5. 11 Temperature dependent carrier density of 0.7wt%...

Ngày tải lên: 10/09/2015, 09:11

307 992 0
Design, synthesis and characterization of smart surfaces and interfaces

Design, synthesis and characterization of smart surfaces and interfaces

... (a) UV-visible absorbance of aqueous solutions of PDMAPS of different concentrations as a function of temperature (b) UV-visible absorbance of aqueous solutions of PDMAPS of different electrolyte ... micrographs of the PVDF-g-P4VP/PNIPAm MF membranes cast by phase inversion from the 12 wt% NMP solution of PNIPAm content of 0.029 in water (pH=6) at different temperatures of (1) 0oC, (2) 25oC, (3) 45oC ... standard pore diameter of d=0.22 µm 12 Figure 5. 1: Schematic illustration of the process of ozone-pretreatment and graft copolymerization of PVDF with inimer BIEA, preparation of “surfaceactive”...

Ngày tải lên: 16/09/2015, 15:54

198 496 0
Preparation and optical characterization of metallic nanoparticles

Preparation and optical characterization of metallic nanoparticles

... 45 3 .5. 3 Analysis of Composition of the Alloys 52 3 .5. 4 Analysis of Surfactants on the Particles 55 3.6 Discussion of the Two Methods 57 3.7 Conclusion ... 89 5. 1 Preparation of AuAg alloy nanoparticles 89 5. 2 Optical Characterization of the Metallic Nanoparticles 90 5. 2.1 Optical Limiting Measurement 90 5. 2.2 Ultrafast ... mole ratio of 0 .5 32 3.2.4.2 Preparation of Ag Nanoparticles 0 .5 ml of the ethanolic dispersion of the Ag (I) ddt (0.005M) was centrifuged to remove the bulk of the ethanol 10 ml of oleylamine...

Ngày tải lên: 16/10/2015, 11:58

102 215 0
Tài liệu Báo cáo khoa học: Specific targeting of a DNA-alkylating reagent to mitochondria Synthesis and characterization of [4-((11aS)-7-methoxy-1,2,3,11a-tetrahydro-5H-pyrrolo[2,1-c][1,4]benzodiazepin-5-on-8-oxy)butyl]-triphenylphosphonium iodide doc

Tài liệu Báo cáo khoa học: Specific targeting of a DNA-alkylating reagent to mitochondria Synthesis and characterization of [4-((11aS)-7-methoxy-1,2,3,11a-tetrahydro-5H-pyrrolo[2,1-c][1,4]benzodiazepin-5-on-8-oxy)butyl]-triphenylphosphonium iodide doc

... 3.4– 4.0 (5H, m, P+–CH2, H-11a and H-3), 1. 75 2.4 (8H, m, O-CH2-CH2, P+–CH2-CH2, H-1 and H-2) p.p.m., 31 PNMR d 25. 65 p.p.m ESMS found (M+) 56 3.2469 calculated for C35H36O3N2P (M+) 56 3.2 458 H (300 ... growth and survival of any q° cells that arise [51 53 ] After 2 .5 weeks of culture ( 15 cell divisions) with mitoDC-81, clones were isolated and allowed to recover in the absence of mitoDC-81 before ... Science 246, 50 0 50 3 52 King, M.P & Attardi, G (1988) Injection of mitochondria into human cells leads to a rapid replacement of the endogenous mitochondrial DNA Cell 52 , 811–819 ´ 53 Gerard, B.,...

Ngày tải lên: 20/02/2014, 11:20

10 640 0
Báo cáo khoa học: Expression and characterization of recombinant 2¢,5¢-oligoadenylate synthetase from the marine sponge Geodia cydonium ppt

Báo cáo khoa học: Expression and characterization of recombinant 2¢,5¢-oligoadenylate synthetase from the marine sponge Geodia cydonium ppt

... p3A2¢p5¢A; 3, p3A2¢p5¢A2¢p5¢A; 4, p3A2¢p5¢A2¢p5¢A2¢p5¢A (m ⁄ z 1493 .5) ; 5, p3A2¢p5¢A3¢p5¢A; 6, p3A3¢p5¢A; 7, p3A3¢p5¢A2¢p5¢A; 8, p3A3¢p5¢A3¢p5¢A; 9, adenosine; 10, mixture of A2¢p5¢A and A2¢p5¢A2¢p5¢A2¢p5¢A; ... A2¢p5¢A2¢p5¢A2¢p5¢A; 11, mixture of A2¢p5¢A2¢p5¢A and A3¢p5¢A2¢p5¢A (m ⁄ z 924.6); 12, A2¢p5¢A3¢p5¢A (m ⁄ z 924.7); 13, putative A2¢p5¢A2¢p5¢A3¢p5¢A (m ⁄ z 1 253 .9); 14, mixture of A3¢p5¢A and A3¢p5¢A3¢p5¢A ... GC (1999) The nature of the catalytic domain of 2¢ -5 -oligoadenylate synthetases J Biol Chem 274, 255 35 255 42 22 Rogozin IB, Aravind L & Koonin EV (2003) Differential action of natural selection...

Ngày tải lên: 23/03/2014, 09:20

13 434 0
Báo cáo khoa học: Characterization of the 5¢ untranslated region of a and b isoforms of the human thromboxane A2 receptor (TP) Differential promoter utilization by the TP isoforms doc

Báo cáo khoa học: Characterization of the 5¢ untranslated region of a and b isoforms of the human thromboxane A2 receptor (TP) Differential promoter utilization by the TP isoforms doc

... +52 , Exon 2); Kin3: 5 -dTGTGGGCCGGAAACAGGGC-3¢ (+ 45 to +27, Exon 2); Kin6: 5 -dGTGGCCCAACGG CAGTTC-3¢ (+3 to +20, Exon 2); Kin16: 5 -dGAGAT GATGGCTCAGCTCCT-3¢ (+724 to +743, Exon 2); Kin 45: 5 -dCCTGATGGGGTGGTGAC-3¢ ... of +1 are given a + designation E1, encodes nucleotides )289 to )84 of 5 untranslated region (UTR) of the TP mRNA; alternatively, exon E1b, of 1 15 bp, located within I1 encodes )199 to )84 of ... (TP) alpha and beta isoforms Biochim Biophys Acta 14 25, 54 3 55 9 18 Habib, A., FitzGerald, G.A & Maclouf, J (1999) Phosphorylation of the thromboxane receptor, the predominant isoform expressed in...

Ngày tải lên: 31/03/2014, 09:20

16 323 0
characterization and optical property of zno nano-,

characterization and optical property of zno nano-,

... Synthesis, characterization and optical properties of multipod ZnO whiskers, Appl Surf Sci 255 (2009) 8667–8671 [5] J Wang, H Zhuang, J Li, P Xu, Synthesis, morphology and growth mechanism of brush-like ... (2011) 53 3 53 5 [13] O Akhavan, M Mehrabian, K Mirabbaszadeh, R Azimirad, Hydrothermal synthesis of ZnO nanorod arrays for photocatalytic inactivation of bacteria, J Phys D: Appl Phys 42 (2009) 2 253 05 ... Lett 92 (2008) 154 102– 154 103 [2] Y Khan, S.K Durrani, M Mehmood, J Ahmad, M.R Khan, S Firdous, Low temperature synthesis of fluorescent ZnO nanoparticles, Appl Surf Sci 257 (2010) 1 756 –1761 [3] Y.F...

Ngày tải lên: 06/05/2014, 13:22

7 580 0
nanoscale characterization of surfaces and interfaces, 1994, p.177

nanoscale characterization of surfaces and interfaces, 1994, p.177

... 3.1 .5 3.1.6 3.1.7 3.2 3.3 3.4 3.4.1 3.4.2 3.4.3 4.1 4.2 4.3 4.4 4 .5 4.6 4.7 5. 1 5. 2 5. 3 5. 4 5. 5 5. 6 Nanoscale Characterization of Surfaces and Interfaces Resistivity in Polycrystalline Metals - ... 74 75 79 86 92 96 96 97 108 111 1 15 118 123 124 1 25 1 25 126 127 128 129 130 132 133 133 134 1 35 137 138 139 141 142 142 142 143 144 144 1 45 146 147 149 150 151 151 List of Symbols and ... 31 32 38 39 40 43 43 43 47 50 50 51 52 53 54 56 58 60 60 64 66 67 68 70 74 2.6.6 2.7 2.8 2.9 2.10 2.11 2.1 1.1 2.1 1.2 2.12 2.13 2.14 3.1 3.1.1 3.1.2 3.1.3 3.1.4 3.1 .5 3.1.6 3.1.7 3.2 3.3 3.4...

Ngày tải lên: 04/06/2014, 14:38

177 429 0
Báo cáo hóa học: " Characterization of MHz pulse repetition rate femtosecond laser-irradiated gold-coated silicon surfaces" pptx

Báo cáo hóa học: " Characterization of MHz pulse repetition rate femtosecond laser-irradiated gold-coated silicon surfaces" pptx

... pressure The radiation fluence used was 0 .5 J/cm2 at a pulse repetition rate of 25 MHz with an interaction time of ms and with the pulse width of 214 fs Three sets of samples were prepared with same ... http://www.nanoscalereslett.com/content/6/1/78 Page of Figure TEM-EDX analysis of the nanoparticles in the aggregate structure showed broadened peaks of Au 4f7/2 and Au 4f5/2 lines Deconvolution of these lines showed the presence of two ... fiber oscillator/amplifier system capable of delivering a maximum of 15 W average power with a pulse repetition rate ranging from 200 kHz to 25 MHz The beam profile is Gaussian and the spot diameter...

Ngày tải lên: 21/06/2014, 06:20

5 280 0
Báo cáo hóa học: " Characterization and Optical Properties of the Single Crystalline SnS Nanowire Arrays" pot

Báo cáo hóa học: " Characterization and Optical Properties of the Single Crystalline SnS Nanowire Arrays" pot

... enlargement of Wavelength (nm) 3.0x10 2.5x10 2.0x10 1.5x10 1.0x10 5. 0x10 (b) 3.0 2.0 0.0 1.0 (αhv) -1 α (cm ) 2 .5 1.0 0 .5 1 .5 2.0 2 .5 3.0 3 .5 hv (eV) Fig Optical properties of SnS nanowires: a is the optical ... doi:10.1021/cg0602 156 18 S Biswas, S Kar, S Chaudhuri, Appl Surf Sci 253 , 9 259 (2007) doi:10.1016/j.apsusc.2007. 05. 053 19 G.H Yue, P.X Yan, J.Z Liu, X.Y Fan, R.F Zhuo, Appl Phys Lett 87, 26 250 5 (20 05) doi:10.1063/1.2 158 521 ... dependence of absorption coefficient on photon energy 123 1 .5 0.0 1.0 1 .5 2.0 2 .5 3.0 hv (eV) Fig The curves of (ahm)2 vs hm for the SnS nanowires 3 .5 Nanoscale Res Lett (2009) 4: 359 –363 the band...

Ngày tải lên: 22/06/2014, 01:20

5 320 0
Báo cáo hóa học: "Synthesis and characterization of Nb2O5@C core-shell nanorods and Nb2O5 nanorods by reacting Nb(OEt)5 via RAPET (reaction under autogenic pressure at elevated temperatures) technique" potx

Báo cáo hóa học: "Synthesis and characterization of Nb2O5@C core-shell nanorods and Nb2O5 nanorods by reacting Nb(OEt)5 via RAPET (reaction under autogenic pressure at elevated temperatures) technique" potx

... 15 20 25 30 35 40 45 50 55 60 65 70 75 80 85 2-theta-Scale Fig (a) An overview of the Letlok used for the RAPET reaction and (b) a cross-section of the Letlok; D: cap, E: union PXRD pattern of ... Nb2O5 nanorods have been synthesized using a one-step RAPET technique Nanoscale Res Lett (2007) 2:17–23 200 (200) (181) 150 (182) (002) (380) 100 123 (010) (381) 50 15 20 25 30 35 40 45 50 55 60 ... 65 70 75 80 85 2-Theta-scale (d) (001) 600 (180) 50 0 400 Lin (counts) The synthesis of Nb2O5@C core-shell nanorods is carried out by the thermal dissociation of pentaethoxy niobate, Nb(OEt )5, ...

Ngày tải lên: 22/06/2014, 22:20

7 358 0
Báo cáo hóa học: " Design and Characterization of a 5.2 GHz/2.4 GHz ΣΔ Fractional-N Frequency Synthesizer for Low-Phase Noise Performance" potx

Báo cáo hóa học: " Design and Characterization of a 5.2 GHz/2.4 GHz ΣΔ Fractional-N Frequency Synthesizer for Low-Phase Noise Performance" potx

... phase noise of the system 0.7◦ rms, 5. 3 GHz kHz–10 MHz [12] 2.4, 5. 1 5. 8 0. 25 μm CMOS −1 15 −1 05 [13] 5. 1 5. 8 0.18 μm CMOS −1 15 −92 0.8◦ rms kHz–10 MHz [14] 5. 1 5. 3 0.18 μm CMOS −110 −92 1 .5 ∼ 2◦ rms ... 10 kHz–10 MHz 2.4, 5. 1 5. 3 0 .5 μm BiCMOS −120 −98 0.4◦ rms, 2.4 GHz 0.7◦ rms, 5. 3 GHz 100 Hz–10 MHz This work agreed closely with the measured results of 0 .5 rms and 0 .53 5◦ rms ACKNOWLEDGMENTS ... digitally calibrated 5. 15- 5.825GHz transceiver for 802.11a wireless LANs in 0.18μm CMOS,” in Proceedings of IEEE International SolidState Circuits Conference (ISSCC ’03), vol 1, pp 352 –498, San Francisco,...

Ngày tải lên: 22/06/2014, 22:20

11 417 0
Báo cáo hóa học: " Research Article Characterization of a Reconfigurable Free-Space Optical Channel for Embedded Computer Applications with Experimental Validation Using Rapid Prototyping Technology" pptx

Báo cáo hóa học: " Research Article Characterization of a Reconfigurable Free-Space Optical Channel for Embedded Computer Applications with Experimental Validation Using Rapid Prototyping Technology" pptx

... values of ε0 and ε1 are (in dB), the better the LCs work 4 EURASIP Journal on Embedded Systems 330 320 310 300 340 350 200 10 20 30 150 330 40 320 310 300 50 60 100 70 290 50 280 340 350 250 200 ... 280 50 270 100 250 260 110 120 240 230 130 220 210 200 190 160 180 170 LC off LC on 150 40 50 90 260 30 150 80 270 10 20 140 80 90 100 250 110 240 120 230 130 140 220 210 200 190 180 170 160 150 ... increasing the optical budget of the system Initial condition P1max P0max Pcrosstalk Increase of transmitter power Use of RZ signal 457 uW 52 uW 36 uW 1923 uW 306 uW 109 uW 1998 uW 65 uW 109 uW...

Ngày tải lên: 22/06/2014, 22:20

7 396 0
Báo cáo khoa học: "Phylogenetic characterization of genes encoding for glycoprotein 5 and membrane protein of PRRSV isolate HH08" docx

Báo cáo khoa học: "Phylogenetic characterization of genes encoding for glycoprotein 5 and membrane protein of PRRSV isolate HH08" docx

... AY737282 DQ 355 796 GQ128443 AY 450 301 EU480 753 EU480 754 EU880443 DQ246 451 EF517962 EF0 759 45 AY74 759 5 FJ947000 FJ919342 DQ379479 AY513611 FJ361891 FJ8 953 29 EF398 052 EU480749 AF121131 31 32 33 34 35 36 ... 2006 20 05 20 05 2008 2007 2000 2000 1998 1992 20 05 2003 2008 20 05 EU480726 EU076704 EU200961 U89392 M96262 EU 755 263 EU 759 973 AY3 950 79 AY3 950 81 AY3 950 78 AY3 950 74 FJ349261 FJ194 950 EU 758 056 EU 758 032 ... FJ8 953 29 EF398 052 EU480749 AF121131 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 04-HZ-1 HKEU16 Jiangxi-3 ATCC VR-2332 Lelystad Neb-1 PRRSV2000000831 SD-01-07...

Ngày tải lên: 07/08/2014, 23:22

7 384 0
Báo cáo khoa học: "Structural and functional characterization of the 5’ upstream region of a glutamine synthetase gene from Scots pine" pdf

Báo cáo khoa học: "Structural and functional characterization of the 5’ upstream region of a glutamine synthetase gene from Scots pine" pdf

... number AJ 2 251 21 Table I Characteristics of introns in the pGS217 pine genomic clone Intron nº Size (bp) (%) A/T (%) Pyrimidines 107 62.6 40 91 63.7 65 282 69.8 50 96 63 .5 40 236 60.4 70 151 63.6 ... end of the incubation period 1/10th of the mix volume of loading buffer was added and samples were loaded on a 5% polyacrylamide 2% glycerol pre-electrophoresed gel Running buffer was 0 .5 × TBE ... electrophoresed in 5% acrylamide gels excised and eluted by diffusion into 0 .5 M NH4OAc Binding was carried out in 15 µl of 10 mM Tris (pH 8), mM EDTA, 100 mM NaCl, mM DTT, 10% glycerol and µg of denatured...

Ngày tải lên: 08/08/2014, 14:20

6 328 0
Báo cáo y học: "Genetic characterization of the cell-adapted PanAsia strain of foot-and-mouth disease virus O/Fujian/CHA/5/99 isolated from swine" doc

Báo cáo y học: "Genetic characterization of the cell-adapted PanAsia strain of foot-and-mouth disease virus O/Fujian/CHA/5/99 isolated from swine" doc

... structure[c] 5 -UTR T82C S Lpro A25T T84C C105T Q26R T55A C119T F68L T138C Y73S A139G P75H T145C D81S T147C K144Q C 155 T Q146H C160T C182T VP2 G72S E136G B-C loop, antigenic site E-F loop T199- K175R G-H ... 1 759 -1780 Pan/204 NK61 ACCTCCAACGGGTGGTACGC GACATGTCCTCCTGCATCTG 154 4- 156 3 3998-4017 P211 CGCTGCCTACCTCCTTCAAT 3726-27 45 P222 ACTATCTCAAAGTTTTCCTTCAG 55 19 -55 41 Pan/201 ACGAGAAGGTGTCGAGCCACC 53 22 -53 42 ... JM, Mason PW: Emergence in Asia of foot-and-mouth disease viruses with altered host range: characterization of alterations in the 3A protein J Virol 2001, 75: 155 1- 155 6 Ome JK, Yeh MT, McKenna TS,...

Ngày tải lên: 12/08/2014, 01:21

11 383 0
Báo cáo y học: " Characterization of a new 5'''' splice site within the caprine arthritis encephalitis virus genome: evidence for a novel auxiliary protein" pot

Báo cáo y học: " Characterization of a new 5'''' splice site within the caprine arthritis encephalitis virus genome: evidence for a novel auxiliary protein" pot

... 2008, 5: 22 http://www.retrovirology.com/content /5/ 1/22 $ 369 6$ JORELQ 6' JORELQ 3RO\$ S. &5 6' 6' S .5 S.5P 3 6$ / 75 S.5P% S .5% E 6' 6' &$*&$$**7$$*7$7&$$&&&&$**7$$*7 $*$7$7$&$*$$& 0DU1 0DU1 0DU6 5% ... Retrovirology 2008, 5: 22 http://www.retrovirology.com/content /5/ 1/22 $ / 75 JDJ / 75 UHY SRO YLI WDW HQY JHQRPLF 0DU 0DU1 E " YLI WDW HQY UHY UHY UWP % 0RFN *60 &$(9 0RFN S.5P% S .5% *60 &$(9 S.5P% S .5% ES 0DU1 ... http://www.retrovirology.com/content /5/ 1/22 $ % FHOOV P S 5W S F5 WP S & 3U(QY 68 S F5 HY FHOOV N'D N'D N'D 70 $QWL 5WP $QWL 5WP &$(9 &'70 & *60 FHOOV N'D N'D $QWL 5WP $QWL &'70 Detection of Rtm expression in...

Ngày tải lên: 13/08/2014, 06:20

17 423 0
w