5 2 a correlation between thermal thickness and other properties

Pyrolysis and combustion processes of combustible materials under external heat flux

Pyrolysis and combustion processes of combustible materials under external heat flux

... Correlation between autoignition time and influencing factors 84 4.4 Correlation between average mass loss and other factors 85 4 .5 Correlation between time at 50 % mass loss and other factors ... 110 5. 2 Experimental design and methodology 110 5. 3 Analysis of raw data 111 5. 4 Comparisons between charring and non-charring polymers 1 12 5. 5 Autoignition time and thermal thickness ... 116 5. 6 Heat release characteristics 121 5. 6.1 Heat release rate 121 5. 6 .2 Heat of combustion 122 5. 7 Mass loss rate 124 5. 8 Gas release rate and gas yield...

Ngày tải lên: 09/09/2015, 11:28

321 497 0
HiPath 3000/5000 Version 4.0Service Manual..Important information1 2 3 4 5 6 7 8 9 10 11 12 A B doc

HiPath 3000/5000 Version 4.0Service Manual..Important information1 2 3 4 5 6 7 8 9 10 11 12 A B doc

... hp3hp5shLOT.fm Tables Tables Table 1-1 Table 1 -2 Table 2- 1 Table 2- 2 Table 2- 3 Table 2- 4 Table 2 -5 Table 2- 6 Table 2- 7 Table 2- 8 Table 2- 9 Table 2- 10 Table 2- 11 Table 3-1 Table 3 -2 Table 3-3 Table ... 3-181 3-183 3-1 85 3-189 3-191 3-194 3-196 3-198 3-199 3 -20 2 3 -20 3 3 -20 3 3 -20 4 3 -2 05 3 -20 6 3 -20 9 3 -20 9 3 -21 1 3 -21 2 3 -21 3 3 -2 15 3 -21 7 3 -21 9 3 -22 0 3 -22 2 3 -22 3 3 -22 6 3 -22 7 3 -22 9 0-17 hp3hp5shLOF.fm Figures ... Table 4-10 Table 4-11 Table 5- 1 Table 5- 2 Table 5- 3 Table 5- 4 Table 5- 5 Table 5- 6 Table 5- 7 Table 5- 8 Table 6-1 Table 6 -2 Table 6-3 Table 6-4 Table 7-1 Table 7 -2 Table 7-3 0 -26 8SLAR Contact Assignments...

Ngày tải lên: 22/03/2014, 15:21

860 6,4K 0
Báo cáo y học: "HLA-DR regulation and the influence of GM-CSF on transcription, surface expression and shedding

Báo cáo y học: "HLA-DR regulation and the influence of GM-CSF on transcription, surface expression and shedding

... neonates Cytokine 20 02; 18 (5) :26 0 -5 19 Bilgin K, Yaramis A, Haspolat K, Tas MA, Gunbey S, Derman O A randomized trial of granulocytemacrophage colony-stimulating factor in neonates with sepsis and ... primer target sequence The primers were designed using Primer Select software (DNA Star) Forward HLA-DR Primer: ATCATGACAAAGCGCTCCAACTAT Reverse HLA-DR Primer: GATGCCCACCAGACCCACAG (Sigma, UK) ... standard, cell lysates and plasma samples were separated using a Mini-PROTEAN® II The separation gel was a 14% polyacrylamide gel (National Diagnostics, Georgia) prepared following manufacturer’s directions...

Ngày tải lên: 03/11/2012, 09:57

11 620 0
Báo cáo khoa học: Identification and characterization of B¢¢-subunits of protein phosphatase 2 A in Xenopus laevis oocytes and adult tissues Evidence for an independent N-terminal splice variant of PR130 and an extended human PR48 protein pot

Báo cáo khoa học: Identification and characterization of B¢¢-subunits of protein phosphatase 2 A in Xenopus laevis oocytes and adult tissues Evidence for an independent N-terminal splice variant of PR130 and an extended human PR48 protein pot

... 24 35 383 26 7 104 103 75 87 157 49 90 177 119 107 2 850 AACGAGgtaggc ATCAAGgtaaga ACACAGgtttga GCAAAGgtaatg GAGAAAgtaagt CTTCAGgtaatt ACCACGgtaggc TTGCAAgtatgc ACCAGGgtaagt AACAAGgtaaga TACCAGgtatga ... the primers 5 -GTTCCTGAGCAAAGTCTTCAATG-3¢ and 5 -GG AATTCAGTGGAAAAACTTTACAT-3¢ for XN73, and the primers 5 -GGAATTCATGCCGACCACAACCGTT TTAAG-3¢ and 5 -GGAGACAGTGACAAGTTATCTA GTGCT-3¢ for XPR70 PCR ... 3¢-Splice acceptor 10 11 12 13  51 5 187 104 103 75 87 157 49 90 176 119 107 27 7 AGAGTAaagt GCCAAGacgt GAGAAAgagt TTGCAGgaga ACCACGgggt CTGCAGgcgg ACCACGgcgt CACACGacgt GACCAGgggt CTGAAGgatg CTCAGGgagt...

Ngày tải lên: 08/03/2014, 08:20

12 508 0
Báo cáo khóa học: The C-terminal t peptide of acetylcholinesterase forms an a helix that supports homomeric and heteromeric interactions potx

Báo cáo khóa học: The C-terminal t peptide of acetylcholinesterase forms an a helix that supports homomeric and heteromeric interactions potx

... Production of antibodies against t 25 ) 40 peptide Anti-(t 25 ) 40) polyclonal Ig was raised in rabbit against the t 25 ) 40 peptide covalently coupled to BSA The t 25 ) 40–BSA conjugate was obtained by reaction ... the characteristic features of an a helical structure, with double minima at 21 0 nm and 22 2 nm The h 222 value of )31 600 degÆdmol)1Æ cm2 indicates that about 85% of the polypeptide is a helical ... constrained by the C-terminal a helix (a1 0) of the catalytic magainins and mastoparans [63,64] and polypeptide hormones; their apolar angle (100°) is similar and the helical domain, so that dimers...

Ngày tải lên: 30/03/2014, 13:20

15 335 0
the handbook of international adoption medicine a guide for physicians parents and providers dec 2004

the handbook of international adoption medicine a guide for physicians parents and providers dec 2004

... Nickman, M.D., Joyce Maguire Pavao, and Adam Pertman My admiration and gratitude are also owed to legislative aide Mark Agrast and Massachusetts Congressman William Delahunt for their work on behalf ... hosting many visits to the orphanages in Murmansk, Russia and for our ongoing research collaborations Thanks are also due to the staff of many orphanages in Kazakhstan, Guatemala, Russia, Nepal, and ... Gaul, who was adopted at age years from Thailand.9 After conviction as a teenager for car theft and credit card fraud, Gaul was deported to Thailand under a 1996 law requiring deportation of any...

Ngày tải lên: 11/06/2014, 10:37

465 586 0
báo cáo hóa học: " Shedding light on walking in the dark: the effects of reduced lighting on the gait of older adults with a higher-level gait disorder and controls" ppt

báo cáo hóa học: " Shedding light on walking in the dark: the effects of reduced lighting on the gait of older adults with a higher-level gait disorder and controls" ppt

... and Rehabilitation 20 05, 2: 27 morbidity and mortality [14] Over one third of the adults aged 65 and over fall at least once each year [14] and among patients with a HLGD, falls are apparently much ... (0 .2 95) 35. 5 ± 3 .2 (0.0 15) 5. 1 ± 2 .5 (0.3 65) 84 .2 ± 33 .5 (0.013) *P-values shown in parentheses are based on within group comparisons between near dark and normal lighting All measures of gait ... effects of an attention demanding task on the gait of healthy young and older adults [ 35, 36] When healthy young or older adults are asked to walk and perform an additional task simultaneously, gait...

Ngày tải lên: 19/06/2014, 10:20

8 417 0
Financial Audit of the Department of Hawaiian Home Lands A Report to the Governor and the Legislature of the State of Hawaii Report No. 02-13 September 2002_part1 ppt

Financial Audit of the Department of Hawaiian Home Lands A Report to the Governor and the Legislature of the State of Hawaii Report No. 02-13 September 2002_part1 ppt

... native Hawaiians The act created a Hawaiian Homes Commission to administer certain public lands, called Hawaiian home lands, for homesteads The purpose of the act was to: Enable native Hawaiians ... Molokai, and Oahu In accordance with the act, the department leases homesteads to native Hawaiians who have at least 50 percent Hawaiian blood Homestead leases may extend up to 199 years for an annual ... of examinations: Financial audits attest to the fairness of the financial statements of agencies They examine the adequacy of the financial records and accounting and internal controls, and they...

Ngày tải lên: 20/06/2014, 02:20

10 382 0
Financial Audit of the Department of Hawaiian Home Lands A Report to the Governor and the Legislature of the State of Hawaii Report No. 02-13 September 2002_part2 pdf

Financial Audit of the Department of Hawaiian Home Lands A Report to the Governor and the Legislature of the State of Hawaii Report No. 02-13 September 2002_part2 pdf

... applications; manages programs and activities in leasing homestead lots for residential, agricultural, and pastoral purposes; and provides homestead lessees loans and other financial assistance The ... department in our Report No 93 -22 , Management and Financial Audit of the Department of Hawaiian Home Lands, and by external auditors in prior financial audits concerning the department’s management ... receipts have been collected and accounted for in accordance with federal and state laws, rules and regulations, and policies and procedures To make recommendations as appropriate Scope and Methodology...

Ngày tải lên: 20/06/2014, 02:20

10 342 0
Financial Audit of the Department of Hawaiian Home Lands A Report to the Governor and the Legislature of the State of Hawaii Report No. 02-13 September 2002_part3 pdf

Financial Audit of the Department of Hawaiian Home Lands A Report to the Governor and the Legislature of the State of Hawaii Report No. 02-13 September 2002_part3 pdf

... Agricultural Pastoral Source FY1997-98 to FY1999-00: Department of Hawaiian Home Lands annual reports Source FY2000-01: Department of Hawaiian Home Lands, "Homestead Area and Islandwide Applications Waiting ... agricultural or pastoral land The cumulative leases awarded as of June 30, 20 01 totaled 7,1 92; applications and cumulative leases awarded for FY2000-01 and the three years prior are shown in Exhibits 2. 1 ... of applications totaled 21 ,56 2, while leases awarded totaled 5, 983 (21 .7 percent) Although leases awarded have now increased 20 percent compared to ten years ago, the number of applications has...

Ngày tải lên: 20/06/2014, 02:20

10 269 0
Financial Audit of the Department of Hawaiian Home Lands A Report to the Governor and the Legislature of the State of Hawaii Report No. 02-13 September 2002_part4 doc

Financial Audit of the Department of Hawaiian Home Lands A Report to the Governor and the Legislature of the State of Hawaii Report No. 02-13 September 2002_part4 doc

... thereon dated February 4, 20 02 We conducted our audit in accordance with auditing standards generally accepted in the United States of America and the standards applicable to financial audits contained ... contracts, and grants That report is an integral part of an audit performed in accordance This is trial version www.adultpdf.com 25 Chapter 3: Financial Audit with Government Auditing Standards and ... America and the standards applicable to financial audits contained in Government Auditing Standards, issued by the Comptroller General of the United States Those standards require that we plan and...

Ngày tải lên: 20/06/2014, 02:20

10 208 0
Financial Audit of the Department of Hawaiian Home Lands A Report to the Governor and the Legislature of the State of Hawaii Report No. 02-13 September 2002_part5 pdf

Financial Audit of the Department of Hawaiian Home Lands A Report to the Governor and the Legislature of the State of Hawaii Report No. 02-13 September 2002_part5 pdf

... budget and actual – general and special revenue fund types for the year ended June 30, 20 01 These salaries, wages, goods, and services aggregated $50 , 25 5 and $ 25 6 ,7 92 for the general and special ... $43, 457 on April 1, 20 05; $ 45, 740 on April 1, 20 06; $48,137 on April 1, 20 07; $50 ,54 8 on April 1, 20 08; and $53 ,074 on April 1, 20 09; interest at 5. 00% to 5. 25 % payable semi-annually 321 ,4 72 $1,746,707 ... $21 0,919 166 ,58 8 168,9 32 171,407 169 ,57 7 1 72, 3 52 1 75, 1 65 178,119 1 25 , 499 1 25 , 979 67, 026 11, 456 3,688 $28 9,814 23 6,400 23 1,389 22 6,1 85 21 6, 651 21 1,671 20 6 ,56 4 20 1,467 141,468 1 35, 24 9 70,937 11,719...

Ngày tải lên: 20/06/2014, 02:20

10 227 0
Financial Audit of the Department of Hawaiian Home Lands A Report to the Governor and the Legislature of the State of Hawaii Report No. 02-13 September 2002_part6 doc

Financial Audit of the Department of Hawaiian Home Lands A Report to the Governor and the Legislature of the State of Hawaii Report No. 02-13 September 2002_part6 doc

... 1,8 25 , 108 7 ,57 8 ,28 2 36 ,26 0,347 - $ 26 ,54 2, 329 26 ,54 2, 329 - 26 ,54 2, 329 $ 17,0 15, 0 42 - - - $ 25 6 ,177,436 22 6,3 12, 671 22 ,371, 951 50 , 6 52 ,998 7 ,57 8 ,28 2 57 3 ,59 6 828 ,400 11,000,100 106,7 65, 0 15 26 ,54 2, 329 ... ( 153 ,110) 2 ,58 8,7 62 13, 853 , 155 36 ,50 0,134 (22 ,646,979) (11 ,26 4,393) 42, 793,411 5, 846 ,56 6 13,180,3 35 22 ,068 ,55 0 966,766 731,194 31 , 52 9,018 1, 359 ,54 6 6, 150 , 52 0 984 ,59 8 11,784,711 497, 122 6 ,55 3,060 ... $1 15, 8 45, 789 109, 121 ,21 8 6,013, 653 48,6 85, 756 57 3 ,59 6 11,000,100 42, 848,113 - $ 58 2, 476 56 4,004 4 95, 938 68,066 - $28 ,611 ,24 3 28 ,610 ,24 3 1 42, 134 828 ,400 27 ,639,709 - $ 67 ,56 4,4 65 61 , 52 2 ,51 6 15, 858 ,779...

Ngày tải lên: 20/06/2014, 02:20

10 223 0
Financial Audit of the Department of Hawaiian Home Lands A Report to the Governor and the Legislature of the State of Hawaii Report No. 02-13 September 2002_part7 doc

Financial Audit of the Department of Hawaiian Home Lands A Report to the Governor and the Legislature of the State of Hawaii Report No. 02-13 September 2002_part7 doc

... (390,000) 62 ,57 7,099 (1, 722 , 121 ) - - (1, 722 , 121 ) 1, 722 , 121 1, 722 , 121 - - - $60,464,978 $ General Loan Fund 2, 978, 25 3 (33 ,21 1) (5, 753 ,081) (5, 753 ,081) 5, 719,870 (22 1) (22 1) - 5, 719,649 5, 719,649 ... sales Other Home Loan Fund 5, 27 7 ,54 9 4,8 62, 741 96,4 35 22 1,766 96,607 4 65, 199 33,147 4 32, 0 52 $10, 958 ,55 2 11,174,6 12 - 11,174,6 12 (21 6,060) 4 ,59 6 ,29 0 4 ,59 6 ,29 0 - (4,8 12, 350 ) $ Operating Fund 62, 187,099 ... 736,1 92 337 ,56 8 69,000 27 , 929 Administration Account and Other $ $ 14,048,406 13,393, 25 8 - 13,393, 25 8 655 ,148 - - 655 ,148 648,030 629 , 327 18,703 - 1,303,178 24 8,406 808,393 24 6, 25 3 126 Native Hawaiian...

Ngày tải lên: 20/06/2014, 02:20

10 202 0
Financial Audit of the Department of Hawaiian Home Lands A Report to the Governor and the Legislature of the State of Hawaii Report No. 02-13 September 2002_part8 pot

Financial Audit of the Department of Hawaiian Home Lands A Report to the Governor and the Legislature of the State of Hawaii Report No. 02-13 September 2002_part8 pot

... Accountants Chainnan Hawaiian Home Lands Commission State ofHawaii We have audited the accompanying combined ~cia1 statementsof the Department of Hawaiian Home Lands, State of Hawaii, as of and ... of approx'mately 300 -50 0 homesteads per year Total applications hav applications per year lands program is dire homestead production a the last decade Whi applicants who "may as many as 40 or 50 ... is appropriate andihas been properly applied We conducted our audit in accordancewith au~ ting standards generally accepted in the United States of America and the standards applicabl to financial...

Ngày tải lên: 20/06/2014, 02:20

10 187 0
w