5  retrieving data from a sub activity back to your main activity

android  cookbook

android cookbook

... Default shared preferences consistency check Advanced text search How to push string-values using Intent.putExtra() Retrieving data from a Sub- Activity back to your Main Activity Getting total and ... system and the reliability and portability of a standard high-level language and API Android apps are written in the Java language, using tools such as Eclipse, compiled against the Android API, and ... Linux-based cell phone projects Android is also related by programming language to Blackberry and JavaME phones, and to Java and the wider realm of Java Enterprise applications Android sales have...

Ngày tải lên: 03/05/2014, 20:40

688 1,4K 0
Tài liệu Module 1: Displaying Data from a Database docx

Tài liệu Module 1: Displaying Data from a Database docx

... connecting to a database by using the Database Results Wizard Lead-in The Database Results Wizard helps to establish a connection between a Web page and a database After importing a database to the ... within a FrontPage-based application, you need to connect to a database using the Database Results Wizard Module 1: Displaying Data from a Database Demonstration: Importing a Database to the ... need to create a connection to the database to access information from a database on a site FrontPage provides the Database Results Wizard to create a connection to the database Delivery Tip Start...

Ngày tải lên: 11/12/2013, 14:15

40 541 0
Tài liệu Retrieving Data from an Oracle Package ppt

Tài liệu Retrieving Data from an Oracle Package ppt

... cmd.Parameters["pCustomerID"].Value = customerIdTextBox.Text; // Create the DataAdapter and table mappings OracleDataAdapter da = new OracleDataAdapter(cmd); da.TableMappings.Add("Table", "ORDERS"); da.TableMappings.Add("Table1", ... da.TableMappings.Add("Table1", "ORDERDETAILS"); // Fill the DataSet from the Oracle package DataSet ds = new DataSet( ); da.Fill(ds); // Create a relation ds.Relations.Add("ORDERS_ORDERDETAILS_RELATION", ... Oracle stored procedure Instead, you must use an Oracle package, that is, a container that groups stored procedures and functions An Oracle package consists of a header and a body The package...

Ngày tải lên: 14/12/2013, 18:16

5 378 0
Tài liệu Updating a Data Source with Data from a Different Data Source doc

Tài liệu Updating a Data Source with Data from a Different Data Source doc

... DataSet tracks changes made to data by maintaining multiple versions of each row allowing the data to be reconciled later to a data source using a DataAdapter The data source to which the DataSet ... destination DataAdapter is called using the DataSet containing the changes as the data object argument; this applies the changes to the destination data source The destination DataSet is then cleared ... source database server, so an Oracle table could be synchronized to reflect all changes made to a SQL Server table In fact, the data sources not even have to be databases If the destination data is...

Ngày tải lên: 21/01/2014, 11:20

4 327 0
Tài liệu Retrieving Constraints from a SQL Server Database docx

Tài liệu Retrieving Constraints from a SQL Server Database docx

... CONSTRAINT_CATALOG nvarchar(128) Constraint name CONSTRAINT_SCHEMA nvarchar(128) Constraint owner CONSTRAINT_NAME sysname TABLE_CATALOG nvarchar(128) Database name TABLE_SCHEMA nvarchar(128) Table ... System.EventArgs e) { // Create the DataAdapter to retrieve schema information SqlDataAdapter da = null; if (primaryKeyRadioButton.Checked) da = new SqlDataAdapter(GETPRIMARYKEYCONSTRAINTS, ConfigurationSettings.AppSettings["Sql_ConnectString"]); ... current database Table 6-10 REFERENTIAL_CONSTRAINTS information schema view Column name Data type Description CONSTRAINT_CATALOG nvarchar(128) Database name CONSTRAINT_SCHEMA nvarchar(128) Constraint...

Ngày tải lên: 26/01/2014, 10:20

7 394 0
Accuracy of Clinical Signs in the Diagnosis of Pulmonary Tuberculosis: Comparison of Three Reference Standards Using Data from a Tertiary Care Centre in Rwanda doc

Accuracy of Clinical Signs in the Diagnosis of Pulmonary Tuberculosis: Comparison of Three Reference Standards Using Data from a Tertiary Care Centre in Rwanda doc

... unilateral apical infiltrates, haemoptysis and cavities, and unilateral apical infiltrates and fever This model provided significant better fit to the data than model Model is a three-latent class ... the data It indicates the amount of the relationship between the variables that remains unexplained by a model; the larger the value, the poorer the model fits the data As a rule of thumb, a good ... estimated Se and Spe of disease characteristics with an LCA strategy [17,27,28] In patients for whom results from at least diagnostic TB tests are available, LCA can distinguish two subgroups: “patients...

Ngày tải lên: 22/03/2014, 18:20

7 508 0
Báo cáo y học: " The prevalence of common mental disorders and PTSD in the UK military: using data from a clinical interview-based study" pdf

Báo cáo y học: " The prevalence of common mental disorders and PTSD in the UK military: using data from a clinical interview-based study" pdf

... Milliken et al (2007) age; percentage for all other variables c UK data weighted to take account of sampling weights d Demographic data are not separately available for those on active duty and those ... statistical power than envisaged as the final response rate was 76% Analysis All statistical analyses were undertaken using the statistical software package STATA (version 10.0) [22] Weighted and ... US data are limited in several ways First, although the data relate to the same Iraq deployment, they were collected in different ways The PDHRA data was collected cross-sectionally in 20056 and...

Ngày tải lên: 11/08/2014, 17:20

12 475 0
báo cáo khoa học: " Detection and validation of single feature polymorphisms using RNA expression data from a rice genome array" pot

báo cáo khoa học: " Detection and validation of single feature polymorphisms using RNA expression data from a rice genome array" pot

... AAATTCAACTCGGAAGAACTCTTCTAACACTTAATCGTTTGTCAATCCCTGAGCCACTGAGGTACTAGGAAGGAAACAAATGA : AAATTCAACTCGGAAGAACTCTTCTAACACTTAATCGTTTGTCAATCCCTGAGCCACTGAGGTACTAGGAAGGAAACAAATGA : AAATTCAACTCGGAAGAACTCTTCTAACACTTAATCGTTTGTCAATCCCTGAGCCACTGAGGTACTAGGAAGGAAACAAATGA ... TGAAGTTGAGTTGTCTTGAAGTGGGTCACTATGAAAACTATCAGCTGTCATTATACTTAACTGGGAAAATGCAATGAAGTTATTTTCTGATTTCTCCTGA : 100 I TGAAGTTGAGTTGTCTTGAAGTGGGTCACTATGAAAACTATCAGCTGTCATTATACTTATCTGGGAAAATGCAATGAAGTTATTTTCTGATTTCTCCTGA ... AAATTCAACTCGGAAGAACTCTTCTAACACTTAATCGTTTGTCAATCCCTGAGCCACTGAGGTACTAGGAAGGAAACAAATGA : AAATTCAACTCGGAAGAACTCTTCTAACACTTAATCGTTTGTCAATCCCTGAGCCACTGAGGTACTAGGAAGGAAACAAATGA : Os s.33510.1.S2 2_at P I F S P I F S GTAGATTTGTAGAGAAACAACCCTGTAAATCCGGTGAT...

Ngày tải lên: 12/08/2014, 03:20

10 252 0
Báo cáo y học: "Hyperuricemia and the risk for subclinical coronary atherosclerosis - data from a prospective observational cohort study" potx

Báo cáo y học: "Hyperuricemia and the risk for subclinical coronary atherosclerosis - data from a prospective observational cohort study" potx

... takes responsibility for the integrity of the data and the accuracy of the data analysis Takeda Pharmaceuticals International, Inc did not have access to the raw data, and Takeda Pharmaceuticals ... Clinical Cardiology Circulation 2006, 114:1761-1791 Tanaka M, Tomiyasu K, Fukui M, Akamabe S, Kobayashi-Takenaka Y, Nakano K, Kadono M, Hasegawa G, Oda Y, Nakamura N: Evaluation of characteristics ... 158) had an Agatston score of greater than 10, and 1.4% (n = 34) had an Agatston score of greater than 100 As expected in a cohort free of clinical CAD, relatively few participants had an Agatston...

Ngày tải lên: 12/08/2014, 15:23

8 352 0
Báo cáo y học: "Health related quality of life in trauma patients. Data from a one-year follow up study compared with the general population" potx

Báo cáo y học: "Health related quality of life in trauma patients. Data from a one-year follow up study compared with the general population" potx

... When an item was missing on the HADS and IES, missing data were replaced with the patients’ mean value for each subscale Data on categorical variables are presented as numbers and percentages, and ... the data, performing the data analyses and writing the article LS also collected data ISB, LS and HM participated in the planning of the study and discussions during data analyses, read the manuscript ... ability to answer the questionnaire was assessed by a nurse at the ward or rehabilitation institution the patient was transferred to after the ICU stay If the patient was assessed unable to answer...

Ngày tải lên: 13/08/2014, 23:20

12 383 0
peachpit press ios 5 in the enterprise, a hands-on guide to managing iphones and ipads (2012)

peachpit press ios 5 in the enterprise, a hands-on guide to managing iphones and ipads (2012)

... you want to maintain control of what apps are installed or deleted, you can that here You can also prevent changes in email accounts, disable camera usage, manage in-app purchases, and disable ... management has to make life easier for the user A happy side benefit to this is that when done right, it makes your life easier, too When a user can personally take an iPhone from activation to ... the address for the email server we use Have a nice day.” But as your company grows, or if you have data that you need to control securely, then you need ensure that your data is set up and managed...

Ngày tải lên: 24/04/2014, 10:00

258 2,7K 0
Báo cáo toán học: "From a Polynomial Riemann Hypothesis to Alternating Sign Matrices" pptx

Báo cáo toán học: "From a Polynomial Riemann Hypothesis to Alternating Sign Matrices" pptx

... This leads to the following equations: a1 + a2 + a3 = a1 t1 + a2 t2 + a3 t3 = a1 tk+2 a1 tk+3 + a2 tk+2 + a3 tk+2 = + a2 tk+3 + a3 tk+3 = Note that the a1 , a2 , a3 cannot be trivial because a1 t2 ... viewed as a single asymptotic version of the Quadratic Polynomial Riemann hypothesis, and again, substantial amount of data indicates its truth On the other hand, this conjecture is readily phrased ... polynomials T [(x + r)n + (1 − x + r)n ](s) (2) satisfy a Riemann hypothesis for all n > and all values of the real parameter r A substantial amount of numerical evidence indicates that a great deal...

Ngày tải lên: 07/08/2014, 06:22

51 206 0
Báo cáo toán học: "From a 1-rotational RBIBD to a Partitioned Difference Family." docx

Báo cáo toán học: "From a 1-rotational RBIBD to a Partitioned Difference Family." docx

... gives rise to a PDF if we allow to have some base blocks of size one It is also trivial to see that a PDF having all blocks of the same size cannot exist What about PDFs having exactly two block ... on V leaving invariant B or R, respectively In particular, a BIBD or RBIBD is said to be 1-rotational under G if it admits G as an automorphism group fixing one point and acting sharply transitively ... immediate to see that each Pi is a parallel class of the BIBD generated by F and G that P1 ∪ ∪ PtG is a G-invariant resolution of it the electronic journal of combinatorics 17 (2010), #R139 Example...

Ngày tải lên: 08/08/2014, 12:22

23 299 0
A soft switch back to back bi directional DC DC converter and the FPGA based digital control design

A soft switch back to back bi directional DC DC converter and the FPGA based digital control design

... Woo Ying Chee and Mr Mukaya Chandra (Electrical Machines & Drives Laboratory) and Mr Abdul Jalil Bin Din (PCB Fabrication Facility) I also thank the National University of Singapore for providing ... changes from half load to full load, (b) load changes from full load to half load Dynamic response of the close loop system in step-up mode operation: (a) load changes from half load to full ... gate -to- source capacitance of MOSFETs, Cds : drain -to- source capacitance of MOSFETs, Cgd : gate -to- drain capacitance of MOSFETs, Rds(ON) : static drain -to- source on-resistance, Vds : drain -to- source...

Ngày tải lên: 12/09/2015, 08:20

232 865 0
Letters from a  Self made merchant to his son

Letters from a Self made merchant to his son

... education IV 31 From John Graham, head at the of the house of Union Stock Yards pont Graham, at the Waldorf-Astoria, Mr Pierrepont has suggested proper finish V to his From John Graham, head Graham ... University, Camat the Mr Pierrepont has just become a member, in good and regular standing, of the Freshman class II From John Graham, at the Union Stock Yards in Chicago, Harvard University to his ... John Graham, at the Union Stock Yards to his son, Pierrepont, at The started 67 in Chicago, Planters' Palace Hotel at Big Gap, Kentucky Mr Pierrepont's orders are small and his expenses are large,...

Ngày tải lên: 08/12/2015, 12:37

128 237 0
 Báo cáo y học: "Sustained High Quality of Life in a 5-Year Long Term Follow-up after Successful Ablation for Supra-Ventricular Tachycardia. Results from a large Retrospective Patient Cohort"

Báo cáo y học: "Sustained High Quality of Life in a 5-Year Long Term Follow-up after Successful Ablation for Supra-Ventricular Tachycardia. Results from a large Retrospective Patient Cohort"

... Female Male AVNRT AVRT EAT From symptom to diagnosis (Years) All patients AVNRT AVRT EAT From symptom to ablation (Years) All patients AVNRT AVRT EAT RF-Applications (Number) All patients AVNRT ... Abbreviations AVNRT: Atrio-Ventricular Nodal Reentry Tachycardia; AVRT: Atrio-Ventricular Reentry Tachycardia; AF: Atrial Fibrillation; EAT: Ectopic Atrial Tachycardia; F: French; INR: International Normalized ... EAT patients Panel A: Quantity and duration of episodes and the associated symptoms Panel B: Detraction in daily life generally and in parts of daily life variable PANAL A Detraction in daily...

Ngày tải lên: 03/11/2012, 11:44

9 681 0
Tài liệu Retrieving a Single Value from a Query pdf

Tài liệu Retrieving a Single Value from a Query pdf

... compared to retrieving a single value using an output parameter or using a DataReader, it allows a single value to be returned with the least code and may therefore improve readability and maintainability ... ExecuteScalar( ) method of the Command object returns a single value from the data source rather than a table or data stream While the ExecuteScalar( ) method does not result in a performance improvement ... therefore improve readability and maintainability If the result set returns more than one result, the first column of the first row is returned as a scalar value A null reference is returned if the...

Ngày tải lên: 14/12/2013, 18:16

2 312 0
w