5  passing a function as an argument to another function

Analyse criterias when there is an m and a and take a company that you know as an example to analyse your criterias analyses

Analyse criterias when there is an m and a and take a company that you know as an example to analyse your criterias analyses

... organizations or companies join together to become a new business • In an acquisition: one business buys a second and generally smaller company Goals Increase in top line revenue Expand in a declining ... Microsoft and their partners • Nokia brings proven capability and talent in critical areas • Ongoing share growth and the synergies across marketing, branding, and advertising Nokia • Be the best path ... regular basis on the combination Geography • • • • Affect adverse selection and moral hazard problems in M &A Hinder acquisitions’ efforts to assess the true value Hamper acquisitions’ ability to...

Ngày tải lên: 08/05/2014, 17:42

17 725 8
Báo cáo y học: "Cost-effectiveness of micafungin as an alternative to fluconazole empiric treatment of suspected ICU-acquired candidemia among patients with sepsis: a model simulatio" ppsx

Báo cáo y học: "Cost-effectiveness of micafungin as an alternative to fluconazole empiric treatment of suspected ICU-acquired candidemia among patients with sepsis: a model simulatio" ppsx

... micafungin MDZ and AFS are consultants to and SK is an employee of Astellas SK is a stock holder in Astellas Pharma US, Inc, the manufacturer of micafungin AFS and MDZ have received research and ... scenario, with all inputs biased against the empiric MIC vs FLU strategy Input Candidemia as % BSI CK/CG as % candidemia Candidemia attributable mortality Candidemia mortality reduction if treated ... expectancy, QALY adjustment and lifetime costs Median age (years) Life expectancy (years) 64 48 to 80 Median from Table S1 in Additional data file 1; range is +/- 25% median 17.4 13.0 to 21.4 Actuarial...

Ngày tải lên: 13/08/2014, 16:21

11 255 0
C++ - I/O Streams as an Introduction to Objects and Classes

C++ - I/O Streams as an Introduction to Objects and Classes

... Education, Inc Publishing as Pearson Addison-Wesley Slide 6- 44 Manipulators  A manipulator is a function called in a nontraditional way  Manipulators in turn call member functions  Manipulators ...  An object is a variable that has functions and data associated with it  in_stream and out_stream each have a function named open associated with them  in_stream and out_stream use different ... contains valid data    Initializing a stream means connecting it to a file The value of the stream variable can be thought of as the file it is connected to Can have its value changed  Changing...

Ngày tải lên: 12/09/2012, 22:49

117 902 0
Báo cáo hóa học: "Error Sign Feedback as an Alternative to Pilots for the Tracking of FEXT Transfer Functions in Downstream VDSL" pptx

Báo cáo hóa học: "Error Sign Feedback as an Alternative to Pilots for the Tracking of FEXT Transfer Functions in Downstream VDSL" pptx

... higher than for reasonable cases: it does not seem reasonable to allow the interference, which is due to changes in the channel, to go significantly above the noise as it would unacceptably decrease ... precanceller) can be viewed as an additional layer working on top of all these operations way of handling this initialization First, the DMT initialization is performed Then transmission can start ... performance So this shows that for a given bit rate usage, a well- EVALUATION OF PERFORMANCE Relation between estimation variance and transmission performance One drawback of the Cramer-Rao bound...

Ngày tải lên: 22/06/2014, 23:20

14 605 0
Báo cáo y học: "Lepirudin as an alternative to “heparin allergy” during cardiopulmonary bypas" pot

Báo cáo y học: "Lepirudin as an alternative to “heparin allergy” during cardiopulmonary bypas" pot

... the patient of the current case report), is a IgE mediated hypersensitivity that can lead to urticarial rash, asthma and anaphylaxis Heparin-induced thrombocytopenia type II, is an immune-mediated ... generalized itching, flushing, bronchospasm, a widespread urticarial red rash and hypotension Parenteral H1 antagonists, and epinephrine was administered promptly and the patient was resuscitated ... patient was commenced on warfarin, in view of the history of TIAs Cardiac angiography revealed normal coronary arteries and confirmed the presence of a large ASD with left to right shunt and was referred...

Ngày tải lên: 10/08/2014, 09:21

5 315 0
Báo cáo y học: "Advanced radiological work-up as an adjunct to decision in early reconstructive surgery in brachial plexus injuries" pptx

Báo cáo y học: "Advanced radiological work-up as an adjunct to decision in early reconstructive surgery in brachial plexus injuries" pptx

... hand and the intraoperative findings on the other hand was estimated by cross tabulation and calculation of kappa coefficient (K-value) The interpretation of kappa values was done according to ... radiological work-up in adult patients with brachial plexus injuries contributed to a better preoperative diagnosis with increased diagnostic accuracy as compared to a clinical examination alone and ... clinical manifestations, conventional imaging findings, and the latest imaging techniques Radiographics 2006, 26(Suppl 1):133-143 Yoshioka N, Hayashi N, Akahane M, Yoshikawa T, Takeshita K, Ohtomo...

Ngày tải lên: 10/08/2014, 10:20

7 361 0
Báo cáo y học: " Immunotherapeutic role of Ag85B as an adjunct to antituberculous chemotherapy" ppt

Báo cáo y học: " Immunotherapeutic role of Ag85B as an adjunct to antituberculous chemotherapy" ppt

... used as an adjunct to chemotherapy and drug dosage can be considerably Page of reduced to once a week with concomitant immunotherapy, as the CFU reduction was same as that of the group where ATD ... infected animals were isolated and cultured on Middlebrook 7H11 agar plates Results are expressed as mean log10 CFUs ± standard deviation of animals per group tested individually Statistical analysis ... counted after a visible bacterial colony appearance and the result was expressed as log10 CFU Cytokine assays The mice were bled at various time points and blood from each group was pooled to isolate...

Ngày tải lên: 11/08/2014, 08:21

8 269 0
Báo cáo y học: "Automated evaluation of autoantibodies on human epithelial-2 cells as an approach to standardize cell-based immunofluorescence tests" pdf

Báo cáo y học: "Automated evaluation of autoantibodies on human epithelial-2 cells as an approach to standardize cell-based immunofluorescence tests" pdf

... data improves data management and provides the basis for efficient exchange of data Automated interpretation systems for cell-based IIF assays can minimize the drawbacks regarding other automated ... (EA1/001/06) Written informed consent was obtained from each patient Detection of anti-nuclear antibodies by HEp-2 cell assay ANAs in patient samples were assessed by commercial ANA assays in accordance ... Diagn Lab Immunol 1996, 3:374-377 doi:10.1186/ar2949 Cite this article as: Egerer et al.: Automated evaluation of autoantibodies on human epithelial-2 cells as an approach to standardize cell-based...

Ngày tải lên: 12/08/2014, 12:20

9 336 0
Báo cáo y học: "Background: Percutaneous tracheostomy (PT) has gained an increasing acceptance as an alternative to the conventional surgical tracheostomy (ST). In experienced hands, and with proper patient selection, it is safe, easy and quick." docx

Báo cáo y học: "Background: Percutaneous tracheostomy (PT) has gained an increasing acceptance as an alternative to the conventional surgical tracheostomy (ST). In experienced hands, and with proper patient selection, it is safe, easy and quick." docx

... No late complication was observed by Fantoni and Ripamonti [7] in nine autopsies and 20 adults after decannulation However, the duration of cannulation was not mentioned An adequate comparative ... them are minor With proper patient selection, operator experience and attention to detail, complication rates can be reduced that may have an influence on late complications An important advantage ... two patients, and more than 50% in one patient In 41 patients examined at least months after decannulation, Law et al [44] found a tracheal stenosis of 10% in four asymptomatic patients by means...

Ngày tải lên: 12/08/2014, 18:20

6 344 0
Báo cáo y học: " Formation of translational risk score based on correlation coefficients as an alternative to Cox regression models for predicting outcome in patients with NSCLC" doc

Báo cáo y học: " Formation of translational risk score based on correlation coefficients as an alternative to Cox regression models for predicting outcome in patients with NSCLC" doc

... A, Uenoyama Y, Kawada M, Kanda N, Sekikawa A, Fukui H, Yanagita M, Yoshibayashi H, Satoh S, Sakai Y, Nakano T, Chiba T: Growth arrest-specific gene and Axl signaling enhances gastric cancer cell ... Cox2 and MMP2, goat anti-mouse for CD68, and rabbit anti-goat for Notch3 and GAS (all obtained from Dako) For semi-quantitative analysis, a grading scale was used: indicated very weak staining ... - 0.70 0.94 Variable Integrated Score for an Individual Risk (ISIR) Assessing risk as a balance of collaborating aggressive and protective variables, the ISIR was calculated as a ratio of weighted...

Ngày tải lên: 13/08/2014, 16:20

13 337 0
Co-operative learning as an approach to improving speaking skills for the second-year non-major students of English at Hanoi University of Business and Technolo

Co-operative learning as an approach to improving speaking skills for the second-year non-major students of English at Hanoi University of Business and Technolo

... learner-centered teaching requires learners to play the role as negotiators and interactors while teachers as facilitators, analysts, counselors and managers In the real classroom, many people, including ... This research is realized with both qualitative and quantitative analysis Quantitative analysis is involved in the process of data collection and analysis, which was carried out at Hanoi University ... materials and activities) and researcher (analyzing and reflecting on data) at the same time, the language teacher should realize that theories and strategies of teaching second language speaking...

Ngày tải lên: 28/03/2015, 09:41

83 1K 2
báo cáo hóa học:" Cross-diagnostic validity in a generic instrument: an example from the Functional Independence Measure in Scandinavia" docx

báo cáo hóa học:" Cross-diagnostic validity in a generic instrument: an example from the Functional Independence Measure in Scandinavia" docx

... the manual was used, however the manuals are quite similar Rasch analysis The Rasch model [12] was used as the methodological basis for examining the internal construct validity, the scaling ... Claesson and Svensson [36] used the rank-invariant statistical method and suggested a scale reduced to four categories, as did also Heinemann and coworkers using Rasch analysis RSM [37] Thus, a reduction ... implementation of such an approach has limitations in that it requires a substantial (and continuing) investment in quality control, training and access to a central facility The validity and reliability of...

Ngày tải lên: 20/06/2014, 15:20

8 301 1
Stock price reaction to the announcement of a reverse stock split, an investigation as a function of the rationale provided

Stock price reaction to the announcement of a reverse stock split, an investigation as a function of the rationale provided

... Descriptive Statistics (includes all cases) 178 Table A6 : Summary of Descriptive Statistics for AREs and CARs 179 Table A7 : ARE and CAR Means and Standard Deviations for No Rationale and Rationale Groups ... requirement SmallCap companies may receive an additional 180 day grace period to achieve compliance Hence, a National Market company may transfer to the Nasdaq SmallCap Market, provided all other ... 1996), as a finer slicing of a given cake (Lakonishok and Lev, 1987), a minor financial maneuver (Futrelle, 1999) and as an arithmetic exercise (Baker and Gallagher, 1980) Copeland (1986) asserts...

Ngày tải lên: 30/09/2015, 16:58

217 234 0
USING BRAND AS AN EFFECTIVE WEAPON TO COMPETE IN THE MARKET: A CASE STUDY OF NHAT LINH COMPANY

USING BRAND AS AN EFFECTIVE WEAPON TO COMPETE IN THE MARKET: A CASE STUDY OF NHAT LINH COMPANY

... competitive market Although a company gets many benefits from its brand name, it is not easy to create and maintain a strong brand To understand more how a company builds and manages its brand to get ... task for any company in a highly competitive market Although a company gets many benefits from its brand name, it is not easy to manage a strong brand To understand more how a company builds and ... Internet, and other sources Data analysis: Qualitative analysis was done for secondary data and primary data collected from interviews Quantitative analysis was done for primary data collected...

Ngày tải lên: 13/04/2013, 10:29

67 979 0
Báo cáo khoa học: "The stylomastoid artery as an anatomical landmark to the facial nerve during parotid surgery: a clinico-anatomic study" pptx

Báo cáo khoa học: "The stylomastoid artery as an anatomical landmark to the facial nerve during parotid surgery: a clinico-anatomic study" pptx

... facial nerve Since on an embryological basis the facial nerve grows into the developing parotid gland and is subject to many different anatomical variations that are not paralleled in branchial ... irrigated and the patient placed in a head down position and an anaesthetic Valsalva manoeuvre is carried out Judicious haemostasis with cautery and ties is carried out before a large 'Haemovac' ... mastoid process and the angle of the mandible allowed a fast and safe identification of the facial nerve and may be of significant help during surgery around the parotid region Pather and Osman...

Ngày tải lên: 09/08/2014, 04:21

5 312 0
Báo cáo y học: "Thread embedded into penile tissue over time as an unusual hair thread tourniquet injury to the penis: a case report" doc

Báo cáo y học: "Thread embedded into penile tissue over time as an unusual hair thread tourniquet injury to the penis: a case report" doc

... become transected, leading to urethrocutaneous fistulation The corpora carvanosa may also become transected, leading to partial or total amputation of the penis distal to the tourniquet [7-9] It ... the hair thread tourniquet was not too tightly applied in the first place The degree of ischemia was therefore not extreme and the associated tissue damage was minimal Over the years, as the patient's ... granulation tissue associated with the ring scar reached only as far as the dense fibrous tissue surrounding the hair thread and did not seem to be related to the urethra http://www.jmedicalcasereports.com/content/2/1/230...

Ngày tải lên: 11/08/2014, 21:22

3 229 0
Báo cáo khoa học: " A dual function TAR Decoy serves as an anti-HIV siRNA delivery vehicle" pot

Báo cáo khoa học: " A dual function TAR Decoy serves as an anti-HIV siRNA delivery vehicle" pot

... Taatacgactcactata gggcatgtcatcagctggg aagacagatctgagccctggga Antisense primer: ttgggcatgtcatcagctgggaagaagaga gctcccagggctcagatctgtcttc TAR-miR-perfect stem configuration: Sense primer: Taatacgactcactata ... Taatacgactcactata gggcctcgtgcctcttcag ctaccacagatctgagcctggga Antisense primer: ttgggcctgtgcctcttcagctaccaagaga gctcccaggctcagatctgtg Anti-TGF-b TARmiR configuration I Sense primer: Taatacgactcactata ... on to demonstrate that the anti-HIV Tar-miRNA construct can function as dual -function therapeutic serving as a TAR decoy as well as an siRNA delivery vehicle This dual function anti-HIV TARmiR...

Ngày tải lên: 12/08/2014, 04:21

9 198 0
A general framework to realize an abstract machine as an ILP processor with application to java

A general framework to realize an abstract machine as an ILP processor with application to java

... engine This approach can take advantage of the increased ILP possible in VLIW machines to achieve high performance [46] The Femtojava [8] and Delft-Java [40] are another two dynamic-translation-supported ... execution that will take place later when tags have been mapped into values That’s why we name it as “tag-based abstract machine translator” Based on the functional descriptions on TAMT, we know that ... extensions to data memory The soft core supports J2ME, JavaCard, KVM, and JINI JStar [112] Nazomi Communications' JStar can work with ARM, and MIPS JStar's Java translation mechanism is automatically invoked...

Ngày tải lên: 11/09/2015, 21:49

172 1,6K 0
w