5 performing a customer smart search

Telesales - Kĩ năng bán hàng qua điện thoại

Telesales - Kĩ năng bán hàng qua điện thoại

... information on creating custom reports on flexfields data Oracle eTechnical Reference Manuals Each eTechnical Reference Manual (eTRM) contains database diagrams and a detailed description of database ... Applications tables are interrelated, any change you make using Oracle Applications can update many tables at once But when you modify Oracle Applications data using anything other than Oracle Applications, ... OTS: Default Universal Search Tab to set which tab (Quick Search, Expanded Search, or Saved Results) appears when you open Universal Search You can search information displayed in dynamic tables...

Ngày tải lên: 13/01/2014, 14:14

256 10,4K 76
Tài liệu Báo cáo Y học: The b-1,4-endogalactanase A gene from Aspergillus niger is specifically induced on arabinose and galacturonic acid and plays an important role in the degradation of pectic hairy regions pdf

Tài liệu Báo cáo Y học: The b-1,4-endogalactanase A gene from Aspergillus niger is specifically induced on arabinose and galacturonic acid and plays an important role in the degradation of pectic hairy regions pdf

... D-galactose and D-galacto-oligosaccharides The calculated areas for D-galactose and D-galacto-oligosaccharides were expressed as percentages of the area of mM D-galactose A niger b-1,4-endogalactanase ... D-galactose and 0.3% L-arabinose and is predominantly linear Potato arabinogalactan consists of 86% D-galactose and 6.6% L-arabinose, while soy arabinogalactan consists of 57% D-galactose and ... characterization of GALA Hydrolysis of arabinogalactans To obtain an A niger transformant that produces increased levels of b-1,4-endogalactanase, a construct was made in which galA was fused to...

Ngày tải lên: 21/02/2014, 01:21

9 669 0
The Importance of Eye Contact in the Classroom

The Importance of Eye Contact in the Classroom

... often, and disapproval occasionally Remind learners that they ought to know an answer or that they could provide a response if they tried Use eye contact as a correction technique Nominate and invite ... watching, someone will give him/her a nudge Eye contact is, fundamentally, time and effort saving Much of the above is likely to seem transparently obvious, only natural, and an aspect of human ... to take place Watch your learners as well as listen to them, particularly while they are performing tasks Look for signs of being bored or being lost Encourage your learners to make eye contact...

Ngày tải lên: 06/09/2013, 10:10

2 699 0
Tài liệu Module 4: Displaying an XML Document Using XSL ppt

Tài liệu Module 4: Displaying an XML Document Using XSL ppt

... (QA Training), Andy Longshaw (Content Masters) Content Lead: Janet Robinson Graphic Artist: Scott Serna (Creative Assets) Media Management: David Mahlmann Media Production: Dean Connolly (Art ... vice versa Note A word of caution with regard to XSL Transformation (XSLT) and XSL: The draft standards are in a constant state of flux, and syntax that is valid today might be invalid in a few ... HTML format Raw data held as XML can be converted into a display format such as HTML for display in a Web browser For example, consider two applications that require the same data but in a different...

Ngày tải lên: 09/12/2013, 17:15

60 469 0
Tài liệu Báo cáo khoa học: An alternative isomerohydrolase in the retinal Muller cells of a cone-dominant species doc

Tài liệu Báo cáo khoa học: An alternative isomerohydrolase in the retinal Muller cells of a cone-dominant species doc

... GATATCTTATGGTTTGTACATCCCATGGAAAG GCGGCCGCCACCATGGTCAGCCGTCTTGAACAC AAGCTTCTAAGGTTTGTAGATGCCGTGGAG TGGGGAGGACTTTTATGCTGT CTTTTGTGTAGGTGGGATTCG CTGAGGTTACAGACAACTGTTC CCTTTGACATCGCAAGTGGATCA TTGAGGTGACAGACAATTGCCT ... CCTTTGACATCGCAAGTGGATCA TTGAGGTGACAGACAATTGCCT TCTTTGACTTCTCAAACTGATCG GCGGCCGCCACCATGCATCATCACCATCAC CATGTCAGCCGTTTTGAACAC GCGGCCGCCACCATGCATCATCACCATCAC CATGTCAGCCGTCTTGAACAC RPE65c-His-Fwd NM_200751 NM_001113653 ... RPE6 5a GSP-Fwd RPE6 5a GSP-Rev 13cIMH GSP-Fwd 13cIMH GSP-Rev RPE65c GSP-Fwd RPE65c GSP-Rev RPE6 5a- His-Fwd NA TGCARRAAYATHTTYTCCAG AYRAAYTCRWRBCCYTTCCA GCGGCCGCCACCATGGTCAGCCGTTTTGAACAC GATATCTTATGGTTTGTACATCCCATGGAAAG...

Ngày tải lên: 14/02/2014, 14:20

14 755 0
Tài liệu Gulf War and Health: Volume 4. Health Effects of Serving in the Gulf War docx

Tài liệu Gulf War and Health: Volume 4. Health Effects of Serving in the Gulf War docx

... Program Associate MICHAEL SCHNEIDER, Senior Program Associate JUDITH URBANCZYK, Senior Program Associate HOPE HARE, Administrative Assistant PETER JAMES, Research Associate DAMIKA WEBB, Research Assistant ... States, Australia, and Denmark) that examined associations of Gulf War deployment with pulmonary-function measures or respiratory disease diagnoses based in part on such measures, such associations ... the Persian Gulf War: Recommendations for Research and Information Systems Washington, DC: National Academy Press IOM 1999 Gulf War Veterans: Measuring Health Washington, DC: National Academy Press...

Ngày tải lên: 16/02/2014, 01:20

292 578 0
Tài liệu Báo cáo khoa học: An intermediate step in the evolution of ATPases – a hybrid F0–V0 rotor in a bacterial Na+ F1F0 ATP synthase pdf

Tài liệu Báo cáo khoa học: An intermediate step in the evolution of ATPases – a hybrid F0–V0 rotor in a bacterial Na+ F1F0 ATP synthase pdf

... 1722–1724 Hirata T, Nakamura N, Omote H, Wada Y & Futai M (2000) Regulation and reversibility of vacuolar H+ATPase J Biol Chem 275, 386–389 Tsunoda SP, Aggeler R, Yoshida M & Capaldi RA (2001) Rotation ... 669–677 Sambongi Y, Iko Y, Tanabe M, Omote H, IwamotoKihara A, Ueda I, Yanagida T, Wada Y & Futai M (1999) Mechanical rotation of the c subunit oligomer in ATP synthase (F0F1): direct observation ... eukaryal V1V0 ATPases has only half the number of ion-binding sites compared to F1F0 ATP syntheses This low H+(Na+) ⁄ ATP ratio is apparently the reason for the inability of eukaryal V1V0 ATPases...

Ngày tải lên: 18/02/2014, 17:20

9 773 0
Tài liệu Báo cáo khoa học: Crystal structure of thiamindiphosphate-dependent indolepyruvate decarboxylase from Enterobacter cloacae, an enzyme involved in the biosynthesis of the plant hormone indole-3-acetic acid doc

Tài liệu Báo cáo khoa học: Crystal structure of thiamindiphosphate-dependent indolepyruvate decarboxylase from Enterobacter cloacae, an enzyme involved in the biosynthesis of the plant hormone indole-3-acetic acid doc

... Marion-Poll, A. , Caboche, M., Kamiya, Y & Koshiba, T (1998) Molecular cloning and characterization of aldehyde oxidases in Arabidopsis thaliana Plant Cell Physiol 39, 433–442 Koga, J., Adachi, T & Hidaka, ... Enterobacter cloacae indolepyruvate decarboxylase, and K.-P Rucknagel (Max¨ Planck-Society, Research Unit ÔEnzymology of protein foldingÕ, Halle/ Saale, Germany) for the amino acid sequence analysis ... E .A & Jordan, F (2001) Catalytic acid-base groups in yeast pyruvate decarboxylase.3 a steady state kinetic model consistent with the behavior of both wild-type and variant enzymes at all relevant...

Ngày tải lên: 20/02/2014, 11:20

10 558 0
Báo cáo khoa học: Transcriptional regulation of the desferrioxamine gene cluster of Streptomyces coelicolor is mediated by binding of DmdR1 to an iron box in the promoter of the desA gene doc

Báo cáo khoa học: Transcriptional regulation of the desferrioxamine gene cluster of Streptomyces coelicolor is mediated by binding of DmdR1 to an iron box in the promoter of the desA gene doc

... GCGGCGACGGCGACGGCAAGAG CGGGGGAGCGGGCGATGACCT GCAGATGCGCGTGCCAGACC CGGCGCCAGTAGCCGACGAAG CGGGTGGCCGCCAAACTCG AGGAAGCGCGGTCAAGGGAGTCTC CGCAAGGCGCTGGCCGAGTTCA TGTGCAGCAGCGGGACGTAGTAGG GGAATTCCGCGCGCGGGTCTGGCTTCA ... Merkamm M, ¨ Guyonvarch A, Elisakova V, Patek M, Kalinowski J, Brune I, Puhler A & Tauch A (2005) Rational design of a Corynebacterium glutamicum pantothenate production strain and its characterization ... apramycin resistance gene as selectable marker using a PCR-based system [31] The plasmid pIJ773 which has a disruption cassette containing the apramycin resistance gene [aac(3)IV] and oriT was...

Ngày tải lên: 16/03/2014, 11:20

13 458 0
Báo cáo khoa học: Secondary structure assignment of mouse SOCS3 by NMR defines the domain boundaries and identifies an unstructured insertion in the SH2 domain pdf

Báo cáo khoa học: Secondary structure assignment of mouse SOCS3 by NMR defines the domain boundaries and identifies an unstructured insertion in the SH2 domain pdf

... Sasaki A, Inagaki-Ohara K, Yoshida T, Yamanaka A, Sasaki M, Yasukawa H, Koromilas AE & Yoshimura A (2003) The N-terminal truncated isoform of SOCS3 translated from an alternative initiation AUG ... B and C and may couple bound proteins to proteasomal degradation Proc Natl Acad Sci USA 96, 2071– 2076 Kamizono S, Hanada T, Yasukawa H, Minoguchi S, Kato R, Minoguchi M, Hattori K, Hatakeyama ... mechanism Cell 86, 577–587 Yasukawa H, Misawa H, Sakamoto H, Masuhara M, Sasaki A, Wakioka T, Ohtsuka S, Imaizumi T, Matsuda T, Ihle JN et al (1999) The JAK-binding protein JAB inhibits Janus...

Ngày tải lên: 16/03/2014, 14:20

11 528 0
Báo cáo khoa học: Deadenylation of interferon-b mRNA is mediated by both the AU-rich element in the 3¢-untranslated region and an instability sequence in the coding region pot

Báo cáo khoa học: Deadenylation of interferon-b mRNA is mediated by both the AU-rich element in the 3¢-untranslated region and an instability sequence in the coding region pot

... Sendaı¨ virus (Cantell strain, ATCC VR-907 Parainfluenza 1) was obtained from Charles River Laboratories [a- 32P]UTP, [a- 35S]UTP and [35S]-Met were purchased from Amersham-Pharmacia Biotech The anti-IFN-b ... cells and total RNA was extracted at the indicated times after the end of transfection 32P-labelled IFN-b mRNA was analysed by agarose gel electrophoresis and autoradiography (C) Polyadenylated ... the case of c-fos, it was shown that ARE mediates mRNA deadenylation by a translationindependent mechanism, while the coding region instability determinant facilitates mRNA deadenylation by a mechanism...

Ngày tải lên: 17/03/2014, 10:20

8 364 0
Báo cáo khoa học: A unique tetrameric structure of deer plasma haptoglobin – an evolutionary advantage in the Hp 2-2 phenotype with homogeneous structure pot

Báo cáo khoa học: A unique tetrameric structure of deer plasma haptoglobin – an evolutionary advantage in the Hp 2-2 phenotype with homogeneous structure pot

... reversetranscribed and PCR-amplified using proofreading DNA polymerase (Invitrogen), forward primer 5¢-TTCCTGC AGTGGAAACCGGCAGTGAGGCCA-3¢ and reverse Structure of deer haptoglobin primer 5¢-CGGAAAACCATCGCTAACAACTAAGCTT ... kDa for the a- chain, which is similar to that of human a2 based on a western blot (Fig 4A) Second, the molecular mass of the a- chain from a purified sample was also similar to that of human a2 ... isolation 982 A B Fig Schematic drawing of the human Hp a- chain and the molecular arrangement of Hp phenotypes (A) The human Hp a1 -chain includes two avaiable )SH groups That at the C-terminus always...

Ngày tải lên: 23/03/2014, 07:20

13 527 0
Báo cáo khoa học: An intermediate step in the evolution of ATPases ) the F1F0-ATPase from Acetobacterium woodii contains F-type and V-type rotor subunits and is capable of ATP synthesis Michael Fritz and Volker Muller ¨ docx

Báo cáo khoa học: An intermediate step in the evolution of ATPases ) the F1F0-ATPase from Acetobacterium woodii contains F-type and V-type rotor subunits and is capable of ATP synthesis Michael Fritz and Volker Muller ¨ docx

... Germany) (A) or blotted against specific antibodies (B) Lane 1: molecular mass marker Lane 2: ATP synthase preparation was denatured by incubation at 80 °C for 10 Lane 3: ATP synthase was heated ... 1/ATPase activity ATPase activity (U/mg) 1/ATPase activity Fig Ion dependence of ATP hydrolysis by the Na+ F1F0-ATP synthase from A woodii ATPase activity was measured at 30 °C using the assay ... 1700–1705 13 Sambongi Y, Iko Y, Tanabe M, Omote H, IwamotoKihara A, Ueda I, Yanagida T, Wada Y & Futai M (1999) Mechanical rotation of the c subunit oligomer in ATP synthase (F0F1): direct observation...

Ngày tải lên: 23/03/2014, 09:20

8 488 0
tiểu luận managing successful organizational change in the public sector

tiểu luận managing successful organizational change in the public sector

... thuyết thay đổi tổ chức tổ chức công (Theories about Organizational change in Public Organization)  Các nhân tố đóng góp vào thay đổi thành công (Factors contribute to successful change) LÝ ... để thay đổi vượt qua kháng lực (Build internal support for change and Overcome resistance)  Phạm vi tham gia rộng rãi trình thay đổi có lẽ phương pháp thường dùng để khắc phục kháng cự thay đổi ... thời gian nỗ lực với nó, quản lý cách F Đảm bảo cam kết hỗ trợ từ quản lý cấp cao (Ensure Top-Management Support and Commitment)  Sự cam kết hỗ trợ từ quản lý cấp cao đóng vai trò quan trọng...

Ngày tải lên: 16/04/2014, 02:30

20 481 0
w