... My plant! ANNIE and BRIDGET No! And here’s a job as a cook ANNIE and BRIDGET No ANNIE Wait a minute! Look at this A waiter! ANNIE What a great idea! BRIDGET Yes! Ooh, I love good looking waiters! ... email] ‘Nadia Hector wants a job.’ HECTOR I am going – to look for a job ANNIE ‘But it’s difficult What can he do? He can’t work in a launderette and he can’t work as a gardener.’ ANNIE My plant! ... Internet, can’t we ANNIE OK, here we are, job vacancies BRIDGET Well, let’s see ANNIE Oh well, there’s a job in a launderette ANNIE and BRIDGET Hector! No! ANNIE And there’s a job as a gardener ANNIE...
Ngày tải lên: 15/03/2014, 17:20
... and South America Brazil Canada Chile Peru United States Europe Asia Belgium China France Japan Germany Taiwan Italy Netherlands Oceania Poland Australia Por tugal New Zealand Spain Switzerland ... Indiana USA 47 201 Tel: (812) 372-0 141 Dorel Distribution Canada Mark Robbins President 2855 Argentina Road, Unit Mississauga, Ontario Canada L5N 8G6 Tel: (905) 8 14- 08 54 Dorel Europe Jean-Claude ... Jean-Claude Jacomin President & CEO 9, Boulevard Gababetta (2nd floor) 92130 Issy Les Moulineaux Paris, France Tel: 00 33 47 65 93 41 Dorel Brazil Rafael Camarano President Setrada Campo Ururai, 143 0...
Ngày tải lên: 30/03/2014, 09:20
báo cáo khoa học: " A compatible interaction of Alternaria brassicicola with Arabidopsis thaliana ecotype DiG: evidence for a specific transcriptional signature" pdf
... CCTTGAGACTCTCTGTAGTATTCACC GATTGAGCTTCTTCTGCTGAGCATC CCAAGCTGATACACTTCCTCTGC CAAGCAGAGAACTCAACACACCAGAG CACAAACCGGGTACTCGTGAG CATCAATGGTGAATGCCTGTCC CTGCACCGAAAGCCCGAGTAATC TAGATTCTCGTAATCTCAGCTCT CAGCGCTTTGAGATTATAGGGTCC ... GTATGCGACGCCCTCAAGGATG GCTGATCTCAGGTCATCCATCTG GGAAAACTGCAGAGCTAAAGGTGG GACCACAACGAGAGTATCTCCGTC GTGAGAGAAGGACTAGCCTACGGTAC GATGAAAACCGCTCTTGACAAATG GTTTGCTTGTCGTGCGGTGAGAG TCGTCTTTGTAGCTCTTGTAGGTG ... CGATTGTGCACCAGCCTCATTGGTT CGTTGTGGCTCTTTACAAACAACAAAAC CGGTGGTACTCCTCCTGGACCCACCGGC GACAACAATGCGGTCGTCAAGG ATGGCAAATATCTCCAGTATTCACA GCTAAGTTTGCTTCCATCATCACCCTT TGCAGCTCGCATAAGCGTTGTGACTGGTA GATGTTGATGAATTGGAGAGGAGGATG...
Ngày tải lên: 12/08/2014, 03:20
A WEB APPLICANTION FOR THE TOURISM INDUSTRY IN HANOI by Dinh Huu Son
... transmission of payment transaction data, and associated remittance advice data, from a payee to their bank, for onforwarding (via banks and/or value-added network operators) to the payee's bank ... can spare or days, you are advised to visit Vientiane, Laos capital with legendary pagodas such as Srisakhet Hortakeo, Thatluang From Hanoi, many interesting tours are available because they are ... Highway No 6A Ha Tay has many famous tourist sites such as Thay Pagoda, Tram Gian 41 Pagoda, Nguyen Trai Temple, the old citadel of Son Tay and particularly, Perfume Pagoda with its most beautiful...
Ngày tải lên: 07/04/2013, 23:51
Tài liệu Module 4: Incorporating CDO for Exchange 2000 into a Web Solution ppt
... You can use CDO for Exchange Management to perform server-side tasks, such as automatically creating and registering users, managing data in Exchange 2000 databases, and managing e-mail accounts ... Management, you can programmatically manage Exchange Define CDO for Exchange Management and describe some applications that can be developed by using CDO for Exchange Management CDO for Exchange ... in calendars, which are folders in the Web Storage System An appointment represents an activity that takes place on a particular date and at a specific time A meeting is an appointment that involves...
Ngày tải lên: 11/12/2013, 14:15
Breaking into the Game Industry: Advice for a Successful Career from Those Who Have Done It
... Publisher and General Manager, Course Technology PTR: Stacy L Hiquet Associate Director of Marketing: Sarah Panella Manager of Editorial Services: Heather Talbot Marketing Manager: Jordan Castellani Acquisitions ... games are still alive Some are still making games They have pioneered a great many genres, mastered programming algorithms and design patterns, and have learned to adapt to platform after platform ... the game industry is home to a great many platforms that are ever-evolving Your ability to understand the foundational languages, C and C++, makes you infinitely more marketable and adaptable across...
Ngày tải lên: 13/02/2014, 17:23
Báo cáo khoa học: "A Bilingual Concordancer for Domain-Specific Computer Assisted Translation" potx
... Philippe Langlais and Guy Lapalme 2010 TRANSSEARCH: from a bilingual concordancer to a translation finder Machine Translation, 24( 3 -4) : 241 –271 Bowker, Lynne, Michael Barlow 20 04 Bilingual concordancers ... ACL, pages 44 0 -44 7 Hong Kong Smadja, Frank, Kathleen R McKeown, and Vasileios Hatzivassiloglou 1996 Translating Collocations for Bilingual Lexicons: A Statistical Approach Computational Linguistics, ... concordancer Then, the returned spotted translation equivalents are evaluated against a manually annotated gold standard in terms of recall and precision metrics We also build two different translation...
Ngày tải lên: 07/03/2014, 18:20
Risks Ahead for the Financial Industry in a Changing Interest Rate Environment pdf
... Datastream bank indices Note that such data are not available for Saudi Arabia b) From 1-Jan-10 to 29-Jul-10 c) Based on banks contained in respective countries' Datastream bank indices d) Based ... banks, in USD billion memo: MV United States United Kingdom Italy France China Australia Japan Russian Federation Canada Brazil Germany Turkey South Korea India South Africa Indonesia Mexico Argentina ... countries are: Austria, Australia, Belgium, Canada, Chile, Chinese Taipei, Finland, France, Germany, Greece, India, Ireland, Italy, Japan, the Netherlands, Norway, Portugal, Singapore, Spain, Sweden,...
Ngày tải lên: 15/03/2014, 01:20
The Sport Psychologist’s Handbook A Guide for Sport-Specific Performance Enhancement ppt
... was the 2001–2002 AAHPERD Alliance Scholar, a fellow in the American Academy of Kinesiology and has received the NASPE Hall of Fame award, the NAGWS Honor Award, the R Tait McKenzie Award, and ... Virginia (USA) and a professor of human services She was awarded the Luther Halsey Gulick Medal from the American Alliance for Health, Physical Education, Recreation and Dance (AAHPERD) in 20 04 Dr ... research-based articles, which have appeared in noted academic journals He has served as a sport psychology consultant for athletes and teams competing at national and international level for...
Ngày tải lên: 17/03/2014, 20:20
Management in India: Grow from an Accidental to a Successful Manager in the IT & Knowledge IndustryA real-world, practical book for a professional in his journey to becoming a successful manager in IndiaRahul Goyalprofessional expertise distilled doc
... to talk to Sign up for formal training and education Summary References Chapter 3: Basic Skills, Traits, and Competencies of a Manager 36 36 38 39 39 40 40 41 41 42 43 44 44 44 45 45 46 46 47 ... compensation The mai-baap manager The Indian manager has a unique role to play, that of mai-baap (mother-father, that is, parents) Many team members also expect the manager to play almost a parental role ... Coordinator Vishal Bodwani Proofreader Aaron Nash Kishore Shenoi Pankaj Ghanshani Indexer Tejal Daruwale Acquisition Editors Amey Kanse Kartikey Pandey Lead Technical Editor Kartikey Pandey Technical...
Ngày tải lên: 23/03/2014, 13:20
Báo cáo hóa học: " Validity and reliability of the Spanish version of the DN4 (Douleur Neuropathique 4 questions) questionnaire for differential diagnosis of pain syndromes associated to a neuropathic or somatic component" docx
... Rejas J, y el grupo para el estudio de la validación al español de la escala LANSS: Adaptación lingüística y validación al español de la escala LANSS (Leeds Assessment of Neuropathic Symptoms and ... by an unrestricted grant from Pfizer Spain The authors wish to thank Francisco González (Hospital de la Princesa, Madrid, Spain), Mar a Madariaga (Hospital de la Princesa, Madrid, Spain) and Carmen ... questionnaire was assessed by a third administration, after at least 48 hours, of the DN4 scale by rater B Stability of the questionnaire was analyzed by measuring the intra-class correlation coefficient...
Ngày tải lên: 18/06/2014, 22:20
Báo cáo y học: "Differential expression, function and response to inflammatory stimuli of 11β-hydroxysteroid dehydrogenase type 1 in human fibroblasts: a mechanism for tissue-specific regulation of inflammation" pps
... Probes and primer sequences used Gene Primers and probes 11β-HSD1 Forward primer: AGGAAAGCTCATGGGAGGACTAG Reverse primer: ATGGTGAATATCATCATGAAAAAGATTC Probe: CATGCTCATTCTCAACCACATCACCAACA H6PDH Forward ... H6PDH Forward primer: CAGGTGTCCTAGTGCACATTGAC Reverse primer: GTAGCCCACTCTCTCGTCCAA Probe: AAGGCACGCCCTCCCAGCG GRα Forward primer: GCGATGGTCTCAGAAACCAAAC Reverse primer: GAGATTACAGAGGAAGTTATCCTCTGC ... Probe: TGCAGTGAAGGTTGCTGAGGCTCTGA GRβ Forward primer: AAC TGG CAG CGG TTT TAT CAA CT Reverse primer: AACTCTTGGATTCTATGCATGAAAATGTTA TGTGGTTA Probe: TGT GTG AGA TGT GCT TTC TGG TT C/EBPα Forward primer:...
Ngày tải lên: 09/08/2014, 08:22
Green Energy and Technology - Energy for a Warming World Part 4 ppsx
... ‘booms’ form a two dimensional horn, at the ‘throat’ of which is a ramp This ramp feeds the enhanced waves towards an artificial lagoon well above sea level The major problem with sea and ocean waves ... be at least m Assessments of technical and economic feasibility of tidal barrages are site specific Some locations are particularly favourable for large tidal schemes because of the focusing and ... of power stations at Manukau harbour and Waitemata harbour, for example, which are relatively equidistant from Auckland, would lessen power supply variations to the city Potential as a Source of...
Ngày tải lên: 09/08/2014, 11:20
Rising Above the Gathering Storm Energizing and Employing America for a Brighter Economic Future phần 4 potx
... Service Award program The US Department of Education, through its Graduate Assistance in Areas of National Need program, also provides traineeships and has a mechanism for identifying areas for grantmaking ... technology list all technology items (information and equipment) that are available for purchase on the overseas open market from foreign or US companies or that have manuals that are available in the ... the agency this way:c Program management at DARPA is a very proactive activity It can be likened to playing a game of multidimensional chess As a chess player, one always knows what the goal is,...
Ngày tải lên: 09/08/2014, 23:20
Feedback.Control.for.a.Path.Following.Robotic.Car Part 4 docx
... Patricia Mellodge Chapter Curvature Estimation 22 Figure 4. 4: A sample image obtained from a camera mounted on the car -1 -2 -1 Figure 4. 5: The vertical Sobel mask applied to the roadway images ... simulate the actual track in the FLASH lab This path Patricia Mellodge Chapter Curvature Estimation 26 Figure 4. 8: The path generated using MATLAB consists of a straight section, a curve of radius ... that if the calculated curvature was less than 0.5, a c(s) value of was used If the calculated curvature was greater than this threshold, c(s) was set to The car was initially placed so that...
Ngày tải lên: 10/08/2014, 02:20
Báo cáo y học: "Bovine herpesvirus 4 based vector as a potential oncolytic-virus for treatment of glioma" pps
... apoptosis of human carcinoma cell lines in vitro and in vivo Cancer research 2005, 65(20): 946 3- 947 2 Yamamoto Y, Murakami K, Inoshima Y, Nakane T, Saika K, Sentsui H: Characterization of a bovine herpesvirus ... type isolated from the spinal cord of a cow with astasia Archives of virology 2000, 145 (11):2363-2370 Redaelli M, Cavaggioni A, Mucignat-Caretta C, Cavirani S, Caretta A, Donofrio G: Transduction ... below the pial surface Injection was carried out for 16 minutes and was performed using a Hamilton syringe Animals were monitored daily for neurological signs and weight loss At the appearance of...
Ngày tải lên: 12/08/2014, 02:20
Báo cáo khoa học: "A catalytically and genetically optimized β-lactamase-matrix based assay for sensitive, specific, and higher throughput analysis of native henipavirus entry characteristics" doc
... 6:119 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 Harty RN, Paragas J, Sudol M, Palese P: A proline-rich motif within the matrix protein of vesicular stomatitis virus and rabies ... USA 20 04, 101:6062-6067 Goh KJ, Tan CT, Chew NK, Tan PS, Kamarulzaman A, Sarji SA, Wong KT, Abdullah BJ, Chua KB, Lam SK: Clinical features of Nipah virus encephalitis among pig farmers in Malaysia ... PBS) and fixed with 2% paraformaldehyde Cells were then acquired using FACS-Diva software on a FACS Aria machine (BD Biosciences, San Diego, CA) with excitation at 40 7 nm and emission at 520 nm and...
Ngày tải lên: 12/08/2014, 04:21
Báo cáo y học: "The SLC2A9 non-synonymous Arg265His variant and gout; evidence for a population-specific effect on severit" docx
... Gender and gender-genotype interaction analysis was performed using STATA Metaanalysis was performed to combine data from independent datasets using Rmeta software (within STATA) to calculate the ... Zealand Jade Hollis-Moffatt was supported by a New Zealand National Heart Foundation Research Fellowship Amanda Phipps-Green, Marilyn Merriman and Ruth Topless are thanked for expert technical ... Sanna S, Maschio A, Busonero F, Usala G, Mulas A, Lai S, Dei M, Orrù M, Albai G, Bandinelli S, Schlessinger D, Lakatta E, Scuteri A, Najjar SS, Guralnik J, Naitza S, Crisponi L, Cao A, Abecasis G,...
Ngày tải lên: 12/08/2014, 15:23
Báo cáo y học: "Human cyclin T1 expression ameliorates a T-cell-specific transcriptional limitation for HIV in transgenic rats, but is not sufficient for a spreading infection of prototypic R5 " ppt
... PCR amplification of a hCycT1 -specific sequence in tail biopsy DNA samples (5'primer: GAT ACT AGA AGT GAG GCT TAT TTG, 3'-primer: CAG ATA GTC ACT ATA AGG ACG AAC) and selected for further matings ... Tcells analyzed in parallel, while the latter typically showed a faster kinetic (Fig 8A and data not shown) Parallel sampling of culture supernatants and p 24 quantification, however, revealed a key ... such an adapted strain could greatly facilitate the identification of host determinants that are critical regulators of late phase-steps of HIV replication Methods Animals The hCD4/hCCR5-tg rats...
Ngày tải lên: 13/08/2014, 05:21