4—toe dressing normal to stress see c8 4 1

Báo cáo khoa học: The ROQUIN family of proteins localizes to stress granules via the ROQ domain and binds target mRNAs pdf

Báo cáo khoa học: The ROQUIN family of proteins localizes to stress granules via the ROQ domain and binds target mRNAs pdf

... ΔRoq 10 000 10 00 10 00 10 00 10 00 10 0 10 0 10 0 10 0 10 10 10 10 1 10 10 0 10 00 10 000 1 10 10 0 10 00 Low None 1 10 000 Hi 10 10 0 10 00 10 000 10 10 0 10 00 10 000 ICOS MFI of Hu ICOS (normalized) 1. 5 N.S ... WT M199R ΔROQ 10 ΔROQ T1/2 = 243 Vector T1/2 = 94 M199R T1/2 = 92 WT T1/2 = 43 Vector Time after actinomycin D (h) huIcosFL B WT 10 000 GFP/Roquin 10 0 huIcos ΔRoq 10 000 WT 10 000 3’UTR ΔRoq 10 ... cells subjected to stress Cell 12 5, 11 11 11 24 Vasudevan S, Tong Y & Steitz JA (2007) Switching from repression to activation: microRNAs can up-regulate translation Science 318 , 19 31 19 34 Brewer BY,...

Ngày tải lên: 15/03/2014, 11:20

19 545 0
Báo cáo khoa học: "A Ranking Approach to Stress Prediction for Letter-to-Phoneme Conversion" doc

Báo cáo khoa học: "A Ranking Approach to Stress Prediction for Letter-to-Phoneme Conversion" doc

... 91 .4 91 .4 61. 2 62.5 Ger P 86.0 90.8 90.9 90 .1 92.6 71. 8 Dut P 81. 1 88.7 88.8 86.6 94. 5 65 .1 (from 88.8% to 91 .4% ) This can be explained by the fact that English vowels are often reduced to schwa ... is stressed or unstressed We use the number 1 to indicate that a substring receives primary stress, ‘2’ for secondary stress, and ‘0’ to indicate no stress We call this output sequence the stress ... Engineering, 13 (1) :1 24 Kenneth Church 19 85 Stress assignment in letter to sound rules for speech synthesis In ACL, pages 246 –253 Steve Pearson, Roland Kuhn, Steven Fincke, and Nick Kibre 2000 Automatic...

Ngày tải lên: 23/03/2014, 16:21

9 332 0
Báo cáo Y học: Atlantic salmon possess three mitogen activated protein kinase kinase 6 paralogs responding differently to stress pot

Báo cáo Y học: Atlantic salmon possess three mitogen activated protein kinase kinase 6 paralogs responding differently to stress pot

... Q9U983; mosquito, Q7PRZ7; ciona, Q4H382 MKK3: chicken, Q5ZL06; cow, A4IFH7; mouse, O0 911 0; human, P467 34 MKK6a: tetraodon, Q4SGJ8; fugu, SINFRUP0000 013 7389; stickleback, ENSGACP000000 14 4 71; medaka, ... JNK-docking sites in MKK7 49 00 16 17 18 19 20 21 promote binding and activation of JNK mitogen-activated protein kinases J Biol Chem 2 81, 13 169 13 179 Enslen H & Davis RJ (20 01) Regulation of MAP kinases ... 3000), anti-phospho-MKK3 ⁄ (1 : 10 00), anti-phosphop38 (1 : 10 00) anti-phospho-MK2 (1 : 10 00), anti-eEF2 (1 : 10 00), anti-pan-MKK6 (1 : 10 00) or anti-MKK6b ⁄ c (1 : 10 00) sera Detection was performed...

Ngày tải lên: 24/03/2014, 00:21

16 249 0
Báo cáo khoa học: "Word or Phrase? Learning Which Unit to Stress for Information Retrieval∗" doc

Báo cáo khoa học: "Word or Phrase? Learning Which Unit to Stress for Information Retrieval∗" doc

... partial 0. 213 5 0. 14 3 3 0 .18 83 0 .18 76 0.2575 0 .18 94 0.23 51 0.2 319 0.3660 0.3333 0 . 41 00 0 .43 24 0.22 54 0 .16 33† 0 .19 88 0.20 31 0.2738 0. 216 5 0.2503 0.2 543 0.3820 0.3600 0 .45 40 0 .49 71 0.2293‡ 0 .16 97‡ 0.2038† ... 0.2038† 0. 210 5† 0.2773 0.2225 0.25 34 0.2589 0 .40 20 0.3933 0 .45 40 0 .49 71 ← 6+7 all partial 0.2380 0.2576 0.2828 0.2990 0 .45 20 0 .45 17 0.2352 0.2528 0.2833 0.2998 0 .45 80 0 .46 21 0. 245 2 0.27 01 0.28 91 0.3099 ... 0 .45 20 0.2229 0 .19 79 0. 249 2† 0.2 716 0. 245 6 0.2959 0.3720 0 .45 00 0 .46 20 0.22 24 0.2025† 0. 249 9† 0.2707 0. 245 7 0.2952 0.3780 0 .45 20 0 .46 00 Metric MAP R-Prec P @10 MAP R-Prec P @10 MAP R-Prec P @10 ...

Ngày tải lên: 30/03/2014, 23:20

9 343 0
Bệnh đau dạ dày và yếu tố stress potx

Bệnh đau dạ dày và yếu tố stress potx

... MỸ QUỐC TẾ Trụ sở: 72 Đường 81, Thị Trấn Phú Mỹ, Tân Thành, Bà Rịa - Vũng Tàu Điện thoại: 0 643 9 21 527 - Hotline: 0938 68 47 68 ( Lương y.Thanh Tuấn) Email: tuan.nt1@phumyquocte.com - Website: ... chuyện, tâm nhận tư vấn trực tiếp Lương y Thanh Tuấn Bạn hoàn to n yên tâm Lương y Thanh Tuấn bắt bệnh chữa trị khỏi bệnh khoảng 4- 7 tuần sử dụng thuốc Các bệnh nhân xa chuyển thuốc đến tận nơi,...

Ngày tải lên: 28/06/2014, 00:20

2 324 0
Báo cáo y học: " Alterations in hippocampal serotonergic and INSR function in streptozotocin induced diabetic rats exposed to stress: neuroprotective role of pyridoxine and Aegle marmelose" doc

Báo cáo y học: " Alterations in hippocampal serotonergic and INSR function in streptozotocin induced diabetic rats exposed to stress: neuroprotective role of pyridoxine and Aegle marmelose" doc

... 5-HT 1. 94 ± 0.22 1. 24 ± 0.23 2.93 ± 0. 31 2.29 ± 0.20 3.29 ± 0.28 2. 14 ± 0.20 a 2. 91 ± 0.36 a 2.96 ± 0.33 a 1. 53 ± 0.29 c 1. 05 ± 0. 31 c 2.73 ± 0. 24 a, b 2 .48 ± 0. 21 a 1. 66 ± 0.22 a, b a c 1. 04 ± ... 0.0 01) and DAP (p < 0.0 01) Diabetic + Pyridoxine Diabetic + Insulin+ Pyridoxine Diabetic + A marmelose Diabetic + A marmelose + Pyridoxine 14 8 .4 ± 2.33 19 6.0 ± 1 .43 14 0 .1 ± 4. 33 18 6 .4 ± 2 .42 3.22 ... receptor specific primary antibody and FITC as secondary antibody The pixel intensity of The pixel intensity of control - 3 8 41 32 ± 14 5 4, diabetic - 13 347 5 ± 14 3 1 a, diabetic+Insulin - 22 912 3 ± 14 5 3...

Ngày tải lên: 10/08/2014, 05:21

15 355 0
Báo cáo y học: " Transient expression of bC1 protein differentially regulates host genes related to stress response, chloroplast and mitochondrial functions" pptx

Báo cáo y học: " Transient expression of bC1 protein differentially regulates host genes related to stress response, chloroplast and mitochondrial functions" pptx

... (B7, B18); DD 11 (B15, B16, B19); and DD12 (B 11, B19), respectively (Figures 1A-C) On the other hand, at dpi same pattern was also observed in DD10 (B2, B3, B4, B8, B10, B 14 , B17, B18, B20), DD 11 ... B10, B 11, B12, B13, B16, B17, B18), and DD12 (B6, B7, B 11, B 14 , B15) respectively (Figures 1D-F) Andleeb et al Virology Journal 2 010 , 7:373 http://www.virologyj.com/content/7 /1/ 373 Page of 12 ... quantification normalized to a reference gene Control Healthy Livak method ΔCT Method Pfaffi Method SA1 Trigger factor (chaperone in protein export) 2.88 17 .75 1 .44 3C/7.727H 1. 08C /1. 74H 1 .44 3C/7.727H...

Ngày tải lên: 11/08/2014, 21:21

12 404 0
báo cáo khoa học: " Sequencing analysis of 20,000 full-length cDNA clones from cassava reveals lineage specific expansions in gene families related to stress response" docx

báo cáo khoa học: " Sequencing analysis of 20,000 full-length cDNA clones from cassava reveals lineage specific expansions in gene families related to stress response" docx

... 54 41 36 29 26 22 22 22 21 19 17 16 16 15 14 14 13 13 13 11 11 11 10 10 10 10 10 10 9 9 9 8 8 11 0 89 69 67 54 31 22 24 29 29 24 24 23 23 24 15 15 20 21 24 16 19 21 11 12 13 14 15 17 10 12 12 15 ... 296(5565): 14 1 - 14 5 http://www.biomedcentral.com/ 14 7 1- 2229/7/66 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 Cortés D, Reilly K, Okogbenin J, Beeching JR, Iglesias C, Tohme J: Mapping ... FL3-5J1 FL5-3P12 FL5-2E17 rd19A FL5-3J4 FL5- 212 3 FL3-2C6 DREB1A FL2-5G7 FL2-1C1 erd3 FL5- 212 2 FL5-1N 11 FL3-27 FL5-95 FL5- 94 FL2-5A4 FL3-5A3 FL5-2G 21 FL5-1A9 FL5-90 FL3-3B1 erd10 rd17 erd7 erd4 FL5-1F23...

Ngày tải lên: 12/08/2014, 05:20

17 223 0
Báo cáo y học: " Is there a protective effect of normal to high intellectual function on mental health in children with chronic illness" docx

Báo cáo y học: " Is there a protective effect of normal to high intellectual function on mental health in children with chronic illness" docx

... (27.8) ( 31. 8) 35 (62.5) Total, n (%) 18 (10 0) 22 (10 0) 56 (10 0) NCI-group Any psychiatric diagnosis (%) 10 (55.6) 11 (50.0) 13 (23.2)* No psychiatric diagnosis (%) Total (%) (44 .4) 18 (10 0) 11 (50.0) ... Chronic illness 2. 04 (1. 11- 3.77) 95% CI p-value Normal to high FSIQ-level versus very low FSIQ-level 236 ( .11 -.53) 0005 Normal to high FSIQ-level versus low FSIQlevel 2 91 (. 14 - . 61) 0 01 02 Kiddie-SADS-PL ... NCIgroup were 56.50 (SD = 9.02, range = 41 -69), 77.95 (SD = 4. 92, range = 71- 84) , and 10 1. 91 (SD = 11 .60, range = 85 -12 6) Psychiatric disorders according to group (CI/NCI) and FSIQ-level In this...

Ngày tải lên: 13/08/2014, 18:21

8 369 0
Báo cáo y học: "Release of extraction-resistant mRNA in stationary phase Saccharomyces cerevisiae produces a massive increase in transcript abundance in response to stress" ppt

Báo cáo y học: "Release of extraction-resistant mRNA in stationary phase Saccharomyces cerevisiae produces a massive increase in transcript abundance in response to stress" ppt

... 19 87, 48 :10 35 -1 046 Wilson TE: A genomics-based screen for yeast mutants with http://genomebiology.com/2006/7/2/R9 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 an altered ... have been submitted to Gene Expression Omnibus series accession number GSE3729 Volume 7, Issue 2, Article R9 R9 .12 Genome Biology 2006, 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 Volume ... oxidative stress and is a target gene for yAP -1 transcriptional regulation Mol Microbiol 19 96, 21: 1 71- 179 Jamieson DJ: Oxidative stress responses of the yeast Saccharomyces cerevisiae Yeast 19 98, 14 : 15 11- 1527...

Ngày tải lên: 14/08/2014, 16:21

13 241 0
Báo cáo y học: " The histone deacetylase Rpd3p is required for transient changes in genomic expression in response to stress" ppt

Báo cáo y học: " The histone deacetylase Rpd3p is required for transient changes in genomic expression in response to stress" ppt

... Mol Cell Biol 19 98, Genome Biology 2009, 10 :R57 http://genomebiology.com/2009 /10 /5/R57 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 Genome Biology 2009, 18 : 512 1- 512 7 Carrozza ... oxidative -stress factor Yap1p [1] , the heat shock factor Hsf1p [12 - 14 ] , Sko1p and Hot1p upon osmotic stress [15 -18 ], and the 'general -stress' transcription factors Msn2p and Msn4p in response to diverse stresses ... of H4Ac 2 0 Log2 Change in Gene Expression wild-type rpd3 pho23 a b c a b c -2 a b -2 c a -2 b a b -2 -4 (c) c XKS1 (b) b -4 -4 -4 0 4 -2 -2 2 -4 10 20 30 Time (min) 60 -4 0 10 20 30 60 10 Time...

Ngày tải lên: 14/08/2014, 21:20

13 291 0
Ethnic differences in cardiovascular response to stress role of trait anger, sex and migrant status

Ethnic differences in cardiovascular response to stress role of trait anger, sex and migrant status

... Light, Sherwood & Turner (19 92) studied a sample of 51 men from 19 88 to 19 89 who had participated in an earlier study conducted between 19 74 and 19 78 At this 10 to 15 year follow-up, high reactivity ... risk (Kamarck et al., 19 97) From an initial sample of 2682 men (19 84- 19 89), 10 38 volunteered for a follow-up Ethnic differences in cardiovascular response to stress 26 (19 91- 1993) Testing at the ... up for 32 to 48 years to examine the risk of premature and total cardiovascular disease associated Ethnic differences in cardiovascular response to stress 21 with anger responses to stress during...

Ngày tải lên: 12/09/2015, 10:57

210 268 0
Characterization of arabidopsis myotubularins AtMTM1and AtMTM2 from development to stress adaptation

Characterization of arabidopsis myotubularins AtMTM1and AtMTM2 from development to stress adaptation

... are four PIKfyve/Fab1p homologs encoded by various genes like At4g33 240 (FAB1A), At3g 14 2 70 (FAB1B), At1g 710 10 (FAB1C), and At1g 342 60 (FAB1D) Out of four only two FAB1A and FAB1B have FYVE domain ... Abiotic Stress Conditions 25 3 .1. 1 .1 Cold Stress 25 3 .1. 1.2 Dark Stress 26 3 .1. 1.3 Salt Stress 27 3 .1. 1 .4 ABA Exposure 27 3 .1. 1.5 Heat Stress 28 3 .1. 1.6 Quantification of GUS Staining by Image ... PtdIns(3,5)P2 1. 5.3 PtdIns5P 10 1. 6 Relationship of PtdIns5P with ATX1 12 1. 7 Myotubularins and Drought Stress 13 1. 8 Aim of the Thesis 13 MATERIALS AND METHODS 16 2 .1 16 Material 2 .1. 1 Plant Material...

Ngày tải lên: 25/11/2015, 14:53

107 158 0
Harvard business review guide to stress management

Harvard business review guide to stress management

... MRP 11 system hooked up to an IBMmainframe with dozens of terminals all ayer the planto Paperwork often took two days to make its way freID one end of the factory to the other Excess inventories, ... Ask your assistants to take detailed messages Ask them always to say you cannottake fuecallat fuemomento (Depending on who it is, your assistants can always undertake to see if you can't be interrupted.) ... difficult, and, not uncommonly, so frustrating that it is easier to talk abolir than to We found four big obstacles to effective participatory management: size, hierarchy, lack of motivarían, and ignorance...

Ngày tải lên: 30/11/2015, 00:52

2 223 0
Báo cáo y học: " Impaired glucose transporter-1 degradation and increased glucose transport and oxidative stress in response to high glucose in chondrocytes from osteoarthritic versus normal human cartilag" pps

Báo cáo y học: " Impaired glucose transporter-1 degradation and increased glucose transport and oxidative stress in response to high glucose in chondrocytes from osteoarthritic versus normal human cartilag" pps

... accession number Glucose transporter -1 Forward: CGTCTTCATCATCTTCACTG 14 8 [Genbank:NM_006 516 ] β-Actin Forward: AACTACCTTCAACTCCAT 16 1 [Genbank:NM_0 011 01] 15 5 [Genbank:NM_0 211 30] Reverse: CTCCTCGGGTGTCTTATC ... 11 :92 -10 1 14 Kelley KM, Johnson TR, Ilan J, Moskowitz RW: Glucose regulation of the IGF response system in chondrocytes: induction of an IGF-I-resistant state Am J Physiol 19 99, 276:R 11 64- R 117 1 ... mimetics, growth factors and pro-inflammatory cytokines Adv Anat Embryol Cell Biol 2008, 200 :1- 84 10 Stenina OI: Regulation of vascular genes by glucose Curr Pharm Des 2005, 11 :2367-23 81 11 Maroudas A:...

Ngày tải lên: 09/08/2014, 14:21

11 432 0
Assessment and quantification of foetal electrocardiography and heart rate variability of normal foetuses from early to late gestational periods 4

Assessment and quantification of foetal electrocardiography and heart rate variability of normal foetuses from early to late gestational periods 4

... 7.3 7.3 47 .0 45 .8 67.6 Lower limit of agreement -15 .6 -13 .0 -44 .3 -1. 8 -53.6 Upper limit of agreement 12 .9 15 .7 14 0 .1 177.6 211 .6 63 .1 33.6 56 .1 28.9 39 .4 55.2 -15 9.7 -15 8.8 -8.3 4. 4 -208.5 -62.9 ... F-EXTRACT 9.5 34. 8 25.7 19 .0 11 .4 Lower limit of agreement -20.2 - 61. 1 -29.7 -6.9 -9 .1 Upper limit of agreement 17 .2 75.3 70.9 67 .4 35.5 310 .7 15 .4 869.0 20.0 1. 2 219 9.7 -662.5 -63.2 -793 .1 -1. 8 -3.6 ... m N N D Iffer en ce in fH R bpm 25 -25 -50 90 16 0 12 0 80 40 -40 -80 -12 0 11 0 13 0 15 0 17 0 40 0 19 0 ms 15 0 10 0 50 -50 -10 0 25 50 75 700 50 -50 600 10 0 D Iffer en ce in r M S S D D ifference in S...

Ngày tải lên: 15/09/2015, 17:11

29 250 0
Khái quát chung về đặc điểm sản xuất kinh doanh và tổ chức quản lý tại Công ty Đầu tư và Xây dựng số 4.DOC

Khái quát chung về đặc điểm sản xuất kinh doanh và tổ chức quản lý tại Công ty Đầu tư và Xây dựng số 4.DOC

... 538 .43 2. 244 .16 2 2.7 31. 133.686 8. 049 .42 2.650 9 . 41 1. 666 .44 2 0 8. 049 .42 2.650 9 . 41 1. 666 .44 2 Lợi nhuận Thuế thu nhập 7 64. 717 .43 2 567.709. 543 . 919 doanh nghiệp Lợi nhuận sau 1. 996 . 41 6.2 54 thuế Có thể nói, ... (: 0 918 .775.368 Báo cáo thực tập tổng hợp Đơn vị tính: VNĐ STT Chỉ tiêu 2005 2006 Tổng doanh thu 48 0 .44 8 .13 0.67 2007 546 .48 1. 666. 81 577 .12 1. 210 .3 61 Tổng chi phí 47 3. 0 41 .6 64. 12 538 .43 2. 244 .16 2 ... chung - Sổ TK 11 1 - Sổ TK 311 - Sổ TK 11 2 - Sổ TK 3 31 - Sổ TK 13 1 - Sổ TK 333 - Sổ TK 13 3 - Sổ TK 3 34 - Sổ TK 13 6 - Sổ TK 335 - Sổ TK 13 8 - Sổ TK 511 - Sổ TK 14 1 - Sổ TK 512 - Sổ TK 14 2 - Sổ TK...

Ngày tải lên: 03/09/2012, 09:17

36 1,1K 4
phan 4 - lap ke hoach to chuc noi dung giao duc.doc

phan 4 - lap ke hoach to chuc noi dung giao duc.doc

... 12 -1 1-2 Các nghề phổ biến Thế giới động vật Thế giới thực vật Luật lệ phương tiện giao thông Các tượng tự nhiên Quê hương – Đất nước – Bác Hồ Tết thiếu nhi 4- 5tuần 4- 5tuần 4- 5tuần tuần ... kiện ) + Ngày 22 -12 , ngày hội quốc phòng to n dân + Tết Dương lịch Trẻ em hôm – Thế giới ngày mai + Ngày 30 -4, ngày giải phóng miền Nam, đất nước Việt Nam hoàn to n thống + Ngày 1- 5, ngày hội người ... thu, tết Trẻ em hôm – Thế giới ngày mai Nguyên đán, Ngày 8-3, Ngày 20 -11 , Ngày sinh nhật Bác 19 -5, Ngày sinh nhật bé, Ngày 1- 6 lễ trường - Ngày hội đến trường : Ngày khai trường coi “ ngày hội...

Ngày tải lên: 05/09/2012, 11:19

43 11,9K 14
w